Nucleic acid molecules encoding a transmembrane serine protease 9, the encoded polypeptides and meth

专利摘要:
Provided herein is a type II transmembrane serine protease 9 (MTSP9) polypeptide. Also provided are the simogen and activating forms of these polypeptides, as well as single and double stranded forms of the protease domain. Using such proteases, methods are provided for identifying compounds that modulate the protease activity of MTSP9.
公开号:KR20030096292A
申请号:KR10-2003-7012622
申请日:2002-03-27
公开日:2003-12-24
发明作者:매디슨에드윈엘；옹에드가오
申请人:덴드레온 샌 디에고 엘엘씨；
IPC主号:

专利说明:

Nucleic acid molecules encoding a transmembrane serine protease 9, the encoded polypeptides and methods based thereon}
[1] US Provisional Application, filed Mar. 27, 2001, entitled "Nucleic Acid Molecules Encoding Transmemline Serine Protease 9, Encoded Proteins, and Methods Based thereon" by Edwin L. Madison and Edgar O. Ong No. 60 / 279,228 and inventor, Edwin L. Madison and Edgar O. Ong, entitled “Nucleic Acid Molecules Encoding Transmemline Serine Protease 9, Encoded Proteins, and Methods Based thereon”, 15 May 2001 Claims benefit of priority over US Provisional Application No. 60 / 291,501, filed date. If allowed, the entirety of the above provisional US application is incorporated herein by reference.
[3] Cancer is the leading cause of death in the United States and is the increase in the number of abnormal neoplastic cells that proliferate to form tumor masses, invasion of adjacent tissues by these neoplastic tumor cells, and through the blood or lymph system to local lymph nodes and distant sites. It is characterized by the development of malignant cells that metastasize. Among the hallmarks of cancer is the disconnection of communication between tumor cells and their environment. Normal cells do not divide in the absence of stimulatory signals and terminate division in the presence of inhibitory signals. Growth-stimulatory and growth-inhibitory signals are routinely exchanged between cells in tissues. In a cancerous or neoplastic state, the cell gains the ability to "overwhelm" the signals and proliferate even under conditions in which normal cells do not grow.
[4] To proliferate, tumor cells acquire a number of unique abnormal properties that disprove genetic modifications. The genome of a particular well-studied tumor has several different independently modified genes, including activated oncogenes and inactivated tumor suppressor genes. Each of these genetic changes appears to be involved in contributing some of the above properties to represent a complete neoplastic phenotype as a whole.
[5] Various biochemical factors have been associated with different stages of metastasis. Cell surface receptors for collagen, laminin, and proteoglycans promote tumor cell adhesion, an important step in invasion and metastasis. Attachment promotes the release of degrading enzymes that promote the penetration of tumor cells through the tissue barrier. Once tumor cells enter the target tissue, certain growth factors are required for further proliferation. Tumor invasion (or progression) involves a complex series of events, in which tumor cells separate from the primary tumor and destroy normal tissue surrounding it, migrate into blood vessels or lymphatic vessels, and deliver to distant sites. Destruction of the normal tissue barrier is achieved by the sophisticated work of specific enzymes that break down the proteins of the extracellular matrix that make up the base membrane and matrix components of the tissue.
[6] Extracellular matrix degrading protein classes have been linked to tumor invasion. Among these are matrix metalloproteinases (MMPs). For example, production of the matrix metalloproteinase stromelysin is associated with malignant tumors with metastatic potential [see, eg, McDonnell et al. (1990) Smnrs. in Cancer Biology 1: 107-115; McDonnell et al. (1990) Cancer and Metastasis Reviews 9: 309-319.
[7] The ability of cancer cells to metastasize and invade tissue is facilitated by basement membrane degradation. Several proteinase enzymes, including MMPs, have been reported to promote tumor cell invasion processes. MMPs are reported to enhance basement membrane degradation, allowing tumor cells to invade tissue. For example, two major metalloproteinases with molecular weights of about 70 kDa and 92 kDa are believed to enhance the metastatic capacity of tumor cells.
[8] Type II transmembrane serine proteases (TTSPs)
[9] In addition to MMPs, serine proteases have had a close effect on neoplastic disease progression. Most serine proteases, secreted enzymes or enzymes sequestered within cellular storage organelles, play a specific role in blood coagulation, wound healing, degradation, immune responses, and tumor invasion and metastasis. A specific class of cell surface proteins named type II transmembrane serine proteases, which are membrane-anchored proteins with additional extracellular domains, have been identified. As cell surface proteins, they are arranged to play a specific role in intracellular signal transduction and also to mediate cell surface proteolysis events.
[10] Cell surface proteolysis is the production mechanism of biologically active proteins that mediate various cellular functions. Membrane-binding proteases include membrane-type metalloproteinases (MT-MMP), ADAMs (proteases containing disintegrin-like and metalloproteinases) and TTPS. In mammals, 17 or more members of the TTSP family are known to comprise 7 in humans. Hooper et al. (2001) J. Biol. Chem. 276: 857-860. These are Corin (Approval numbers AF133845 and ABO13874) [Yan et al. (1999) J. Biol. Chem. 274: 14926-14938; Tomia et al. (1998) J. Biochem. 124: 784-789; Uan et al. (2000) Proc. Natl. Acad. Sci. U.S.A. 97: 8525-8529; Enterpeptidase (also called enterokinase; accession number U09860 for human proteins) (Kitamoto et al. (1995) Biochem. 27: 4562-4568; Yahagi et al. (1996) Biochem. Biophys. Res. Commun. 219: 806-812; Kitamoto et al. (1994) Proc. Natl. Acad. Sci. U.S.A. 91: 7588-7592; Matsushima et al. (1994) J. Biol. Chem. 269: 19976-19982; Human airway trypsin-like protease (HAT; Accession No. AB002134) [Yamaoka et al. J. Biol. Chem. 273: 11894-11901; MTSP1 and Matriptase (also referred to as TADG-15, see SEQ ID NOs: 1 and 2, Accession Nos. AF133086 / AF118224, AF0420022). Takeuchi et al. (1999) Proc. Natl. Acad. Sci. U.S.A. 96: 11054-1161; Lin et al. (1999) J. Biol. Chem. 274: 18231-18236; Takeuchi et al. (2000) J. Biol. Chem. 275: 26333-26342; And Kim et al. (1999) Immunogenetics 49: 420-429; Heptin (approval number M18930, AF030065, X70900) by Leytus et al. (1998) Biochem. 27: 11895-11901; Vu et al. (1997) J. Biol. Chem. 272: 31315-31320; And Farley et al. (1993) Biochem. Biophys. Acta 1173: 350-352; And US Pat. No. 5,972,616; TMPRS2 (approval numbers U75329 and AF113596) [Paoloni-Giacobino et al. (1997) Genomics 44: 309-320; And Jacquinet et al. (2000) FEBS Lett. 468: 93-100; And TMPRSS4 (approved NM016425) by Wallrapp et al. (2000) Cancer 60: 2602-2606.
[11] Serine proteases, including transmembrane serine proteases and secreted proteases, have had a close impact on the processes involved in neoplasia and progression. Although the precise and detailed mechanism by which proteases promote tumor proliferation and progression has not yet been identified, serine proteases and their inhibitors are responsible for cancer cell invasion, metastatic spread and degradation in tumor angiogenesis, which are associated with tumor progression. It is involved in the regulation of many intracellular and extracellular physiological processes, including. Proteases are involved in the degradation of the extracellular matrix (ECM) and cause tissue remodeling and are believed to be necessary for cancer invasion and metastasis. The activity and / or expression of several proteases have been found to correlate with tumor progression and development.
[12] For example, epithelial cancer and normal tissues [Takeucuhi et al. (1999) Proc. Natl. Acad. Sci. USA 96: 11054-61] Membrane-type serine protease MTSP1 (also referred to as Matriptase) (SEQ ID NOs: 1 and 2 from US Pat. No. 5,972,616; And GenBank Accession No. AF118224; (1999) J. Biol. Chem. 274: 18231-18236; U. S. Patent No. 5,792,616; Takeuchi (1999) Proc. Natl. Acad. Sci. U. S. A. 96: 11054-1161. Matriptase was first identified in human breast cancer cells as a major gelatinase (see US Pat. No. 5,482,848) and was initially considered to be a type of matrix metalloprotease (MMP). It has been reported to be involved in breast cancer metastasis. Matriptase is also expressed in various epithelial tissues at high activity and / or expression levels in the human gastrointestinal tract and prostate. MTSPs, designated MTSP3, MTSP4, MTSP6, have been reported in WO 01/57194 (PCT International Application PCT / US01 / 03471).
[13] The kallikrein-like serine protease, the prostate-specific antigen (PSA), was considered to degrade the extracellular matrix glycoprotein fibronectin and laminin and to promote invasion by prostate cancer cells. Webber et al. (1995) Clin. Cancer Res. 1: 1089-94. Blocking PSA proteolytic activity with PSA-specific monoclonal antibodies results in a dose-dependent in vitro reduction of invasion of reconstituted basement membrane Matrigel by LNCaP human prostate carcinoma cells that secrete high levels of PSA. .
[14] Hepsin, a cell surface serine protease identified in liver cancer cells, is overexpressed in ovarian cancer. Tanimoto et al. (1997) Cancer Res., 57: 2884-7. Heptin transcripts are considered abundant in carcinoma tissues and are rarely expressed in normal adult tissues, including normal ovaries. Since heptin is frequently overexpressed in ovarian tumors, it has been suggested that it can be a candidate protease in the invasive process and growth capacity of ovarian tumor cells.
[15] A serine protease-like gene named Normal Epithelial Cell-Specific 1 (NES1) has been identified (Liu et al., Cancer Res., 56: 3371-9 (1996)). Although expression of NES1 mRNA is observed in all normal and immortalized non-tumoral epithelial cell lines, the majority of human breast cancer cell lines appear to have markedly reduced or little expression thereof. Structural similarity of NES1 to polypeptides known to modulate growth factor activity and negative correlation between NES1 expression and breast oncogenesis play a direct or indirect role in the protease-like gene product in inhibiting tumorigenesis. Suggest that you do.
[16] Thus, transmembrane protease is believed to be related to the pathogenesis and pathogenicity of tumors. There is a need to clarify their role in the process and to identify additional transmembrane proteases. It is therefore an object of the present invention to provide a transmembrane serine protease (MTSP) protein involved in or participating in the regulation of tumorigenesis and / or carcinogenesis and nucleic acids encoding such MTSP protease. It is also an object of the present invention to provide prognostic, diagnostic and therapeutic screening methods using the proteases and nucleic acids encoding such proteases.
[17] Summary of the Invention
[18] The functional activity and / or expression is described herein in the transmembrane serine protease family, in particular the type II transmembrane serine protease (TTSP) family (also referred to herein as MTSPs), and more particularly in tumor cells and non-tumor cells in the same tissue. Members of different TTSP families are provided. The MTSP provided herein is a member of the MTSP family designated herein as MTSP9. Also provided are proteins of full length, including protease domains and zymogens and activated forms, and uses thereof. Proteins encoded by splice variants are also provided.
[19] Also provided herein are assays to identify effectors such as compounds including small molecules, and conditions such as pH, temperature and ionic strength that modulate the activation, expression or activity of MTSP9. In an exemplary assay, the effect of a test compound on the ability of the protease domain of MTSP9 to proteolytically cleave known substrates, typically labeled at fluorescent, pigmentative or detectable levels, is assessed. Agents that modulate the activity of protein proteases, generally compounds, especially small molecules, are candidate compounds for modulating the activity of MTSP9. Protease domains can also be used to generate protease-specific antibodies. The protease domain provided herein is, for example, a Zimogen of an MTSP family member comprising MTSP9 from a mammal, including humans, which is expressed on tumor cells at different levels than non-tumor cells and not on endothelial cells. A cleavage site for the activation of a N-terminus to a C-terminus, or a C-terminal truncated portion that exhibits proteolytic activity as a single chain polypeptide in an in vitro proteolytic assay, but However, the present invention is not limited thereto.
[20] Nucleic acid molecules encoding protein and protease domains are also provided. Nucleic acid molecules encoding single-chain protease domains or catalytically active portions thereof, and nucleic acid molecules encoding full-length MTSP9 are provided. Nucleic acids encoding protease domains (SEQ ID NOs: 31 to 729) and nucleic acids upstream of SEQ ID NO: 5; And the protease domain of MTSP9 is shown in SEQ ID NO: 6 (amino acids 11-232) and SEQ ID NO: 16. The protein sequence and the full-length encoding nucleic acid of MTSP9 are shown in SEQ ID NOs: 18 and 17.
[21] Nucleic acid molecules are provided that hybridize with nucleic acids encoding MTSP9 along their full length or along about 70%, 80% or 90% of their full length, and encode protease domains or portions thereof. Hybridization is generally performed under at least low, generally at least moderate, and often high stringent conditions.
[22] An isolated nucleic acid fragment may be DNA or RNA comprising a genome or cDNA or may include other components such as protein nucleic acids or other nucleotide homologs. An isolated nucleic acid may comprise additional components, such as heterologous or natural promoters, and other transcriptional and translational regulatory sequences, which may be combined with other genes, such as reporter genes, or genes encoding other indicator or indicators. have.
[23] Also provided are isolated nucleic acid molecules comprising a molecular sequence complementary to the nucleic acid sequence encoding MTSP9 or a portion thereof.
[24] It can also be used as a probe or primer and contains about 10, 14, 16 or more nucleotides, or generally less than 1000 or less than 100, or about 30, as set forth in SEQ ID NO: 5 or 17 (or its complement) Provided are oligonucleotides or fragments thereof that contain more than nucleotides (or complements thereof) or that contain oligonucleotides or any fragments thereof and oligonucleotides that hybridize along their full length (or at least 70, 80, or 90% thereof). do. The length of the fragments is a function of the purpose for which they are used and / or the complexity of the desired genome. Generally probes or primers contain up to about 50, 150, or 500 nucleotides.
[25] Also provided are plasmids containing any of the nucleic acid molecules provided herein. Cells containing such plasmids are also provided. Such cells include, but are not limited to, bacterial cells, yeast cells, fungal cells, plant cells, insect cells and animal cells.
[26] Also provided is a method of producing MTSP9 by growing said cells under conditions expressing MTSP9 by said cells and recovering the MTSP9 polypeptide thus expressed. Also provided are methods for isolating nucleic acids that express other MTSP9.
[27] Also provided are cells that express MTSP9 polypeptide at the cell surface, generally eukaryotic cells such as mammalian cells and yeast cells. The cells are used in drug screening assays to identify compounds that modulate the activity of MTSP9 polypeptide. These assays include in vitro binding assays and transcription-utilized assays that assess signal translation, directly or indirectly mediated by MTSP9, eg, through activation of growth promoters.
[28] Also provided are peptides encoded by such nucleic acid molecules. These polypeptides include MTSP9 protease domains, or polypeptides exhibiting amino acid changes such that specificity and / or protease activity remain substantially unchanged. In particular, substantially purified mammalian MTSP9 polypeptides are provided that include a serine protease catalytic domain and may additionally include other domains. MTSP9 may form homodimers and may also form heterodimers with some other proteins, such as membrane-bound proteins. MTSP9 and 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93 Substantially purified proteins are provided that comprise at least%, 94%, 95%, 96%, 97%, 98%, 99% identical amino acid sequences, where% identity is the standard algorithm and gap penalty that maximizes% identity. Determined using (gap penalty). Although human MTSP9 polypeptides are exemplified, other mammalian MTSP9 polypeptides are also contemplated. Splice variants of MTSP9, in particular variants with proteolytically active protease domains, are contemplated herein.
[29] In other embodiments, substantially purified polypeptides are provided that include the protease domain of the MTSP9 polypeptide or catalytically active portion thereof, but do not include the entire amino acid sequence set forth in SEQ ID NO: 18. These include polypeptides comprising an amino acid sequence which shows at least 60%, 70%, 80%, 85%, 90%, 95% or 100% sequence identity with SEQ ID NO: 16 or 18.
[30] In specific embodiments, nucleic acids encoding MTSPs designated MTSP9 are provided. In particular, the nucleic acid comprises nucleotide portions encoding SEQ ID NO: 5, in particular nucleotides 31-729 of SEQ ID NO: 5, or the nucleotide sequence set forth in SEQ ID NO: 17 or the catalytically active polypeptide.
[31] Also provided are nucleic acid molecules that hybridize to SEQ ID NO: 5 or 17, or a degenerate thereof, at least under low, generally moderate, and more typically high stringency conditions.
[32] In one embodiment, the isolated nucleic acid fragment is hybridized with a nucleic acid molecule containing the nucleotide sequence set forth in SEQ ID NO: 5 or 17 (or a degenerate thereof) under high stringent conditions, and in one embodiment in SEQ ID NOs: 5 and 17 It contains the nucleotide sequence shown. Full length MTSP9 is shown in SEQ ID NO: 18, which is encoded by SEQ ID NO: 17 or a degenerate thereof.
[33] In addition, a mutein of the single-stranded protease domain of MTSP9, in particular a free Cys residue in the protease domain (ie, not forming a disulfide linkage with any other Cys residue in the protease domain), is not necessarily another amino acid substituent, but typically There are provided muteins substituted with conservative amino acid substituents or substituents that do not remove activity, and muteins from which glycosylation site (s) have been removed.
[34] Thus, one or more Cys residues, in particular pairs of activated two forms, or residues that are not paired with the protease domain alone (residue Cys at position 26 (SEQ ID NOs: 5, 6 and 16) in the protease domain) are any amino acid. Typically, but not necessarily, muteins substituted with conservative amino acid residues such as Ser are contemplated. A mutein of MTSP9 is provided, in particular a mutein in which Cys residues such as unpaired Cys in the single-chain protease domain are replaced with another amino acid that does not remove activity. Muteins substituted with other conservative or non-conservative amino acid substituents retaining catalytic activity are also contemplated (see Table 1 for exemplary amino acid substituents).
[35] Provided herein are nucleic acids encoding MTSP9 polypeptides (including, but not limited to, splice variants thereof), and MTSPs, and domains, derivatives, and homologues thereof. Also provided are single-chain protease domains containing the N-terminus generated by activating the simogen form of MTSP9. The cleavage site for the protease domain of MTSP9 is between amino acids R ₁₈₆ and amino acids I ₁₈₇ (R ↓ IASG). There are potential N-glycosylation sites at N ₁₅₃ and N ₃₀₃ . Disulfide bonds between the Cys residues C ₁₇₅ -C ₂₉₂ are formed to bind the protease domain and another domain, and the polypeptide obtained upon cleavage is two chain molecules. The following potential disulfide bonds exist: C ₂₁₂ -C ₂₂₈ , C ₃₃₇ -C ₃₅₃ and C ₃₆₄ -C ₃₉₃ . Thus, C ₂₉₂ is free Cys in the single-chain form of the protease domain, which can also serve as a double-stranded molecule. However, herein the single and double strand forms are shown to be proteolytically active.
[36] Thus, provided herein is a transmembrane serine protease (MTSP) family, designated MTSP9, and functional domains thereof, in particular protease (or catalytic) domains, muteins, and other derivatives and homologues thereof. Also provided herein are nucleic acids encoding MTSP9.
[37] MTSP is of interest because it is believed to be expressed and / or activated at a different level than normal cells in tumor cells and to exhibit different functional activity, eg, substrate or cofactor changes, to normal cells in tumor cells. Are concentrated. MTSP9 is interesting because it is expressed in or active in tumor cells. Thus, the MTSPs provided herein can act as diagnostic markers for certain tumors.
[38] Of interest here are MTSPs that are expressed or activated in certain tumors or cancer cells such as lung, prostate, colon and breast cancer. In particular, it is shown herein that MTSP9 is expressed and / or activated in a variety of tumor cells, including, for example, lung carcinoma, leukemia, and cervical carcinoma, as well as certain normal cells and tissues (implementation for tissue specific expression profiles). See example). MTSP9 may also be a marker of breast, prostate and colon cancer. Expression and / or activity of MTSP9 near cells or in the body fluids of a subject may be markers for breast, prostate, lung, colon and other cancers.
[39] In certain embodiments, the MTSP9 polypeptide can be detected in body fluids at a level different from that in the body fluids of a tumor-free subject. In other embodiments, the polypeptide is present in the tumor; Substrates or cofactors for such polypeptides are expressed at different levels than expression levels in non-tumor cells in the same type of tissue. In other embodiments, the expression and / or activity level of MTSP9 polypeptide in tumor cells is different from the expression and / or activity level in non-tumor cells. In other embodiments, MTSP9 is present in the tumor; Substrates or cofactors for MTSP9 are expressed at different levels than expression levels in non-tumor cells in the same type of tissue.
[40] Also provided are methods for screening compounds that modulate the activity of MTSP9. Compounds are identified by contacting the compound with MTSP9 or a protease domain thereof and a substrate for MTSP9. Compared to the amount of substrate cleaved in the absence of the compound, changes in the amount of substrate cleaved in the presence of the compound indicate whether this compound modulates the activity of MTSP9. The compound is selected for further analysis or for use in modulating the activity of MTSP9, eg, as an inhibitor or agonist. The compounds can also be identified by contacting the substrate with a cell expressing MTSP9 or an extracellular domain or a proteolytically active portion thereof.
[41] Also provided herein are methods of modulating the activity of MTSP9 and screening for compounds that inhibit, antagonize, agonize or otherwise modulate the activity of MTSP9. Of particular interest is the extracellular domain of MTSP9, which includes the proteolytic (catalytic) portion of the protein of interest.
[42] Also provided herein are cells, combinations, kits and articles of manufacture containing MTSP9, domains thereof, or encoding nucleic acids. Methods of expressing encoded MTSP9 polypeptides and portions thereof using such cells as expressing MTSP9 on a cell surface are provided. The cells are used in the method of identifying candidate therapeutic compounds.
[43] In addition, provided herein are antibodies, cells, combinations, preparation kits and articles containing antibodies that specifically bind single-stranded and double-stranded MTSP9. Antibodies that specifically bind MTSP9, in particular single-stranded protease domains, double-stranded protease domains, simogens and activated forms of MTSP9 and other fragments thereof are provided. Neutralizing antibodies that inhibit biological activity, in particular protease activity, are also provided.
[44] Further provided herein are methods of prognostic, diagnostic, therapeutic screening using nucleic acid molecules encoding MTSP9 and MTSP9. In particular, such prognosis, diagnostic and therapeutic screening methods are used to find or find agents useful for preventing or treating cancer or tumors, such as lung carcinoma, colon adenocarcinoma and ovarian carcinoma.
[45] Also provided herein are modulators of activity of MTSP9, in particular modulators obtained according to the screening methods provided herein. Such modulators can be used to treat cancer diseases and other neoplastic diseases.
[46] A method of diagnosing a disease or disorder is provided, which comprises detecting abnormal levels of MTSP9 in a subject. This method can be carried out by measuring the DNA, RNA, protein or functional activity level of MTSP9. In comparison to the DNA, RNA, protein or functional activity level of MTSP found in similar samples (or other suitable controls) without disease or disorder, the increase or decrease in the DNA, RNA, protein or functional activity level of MTSP is determined by the subject or other relevant Indication of the presence of the disease or disorder in all controls.
[47] In addition, the test compound is contacted with both the single and double stranded forms of MTSP9; Determine the form to which the compound is bound, and when the compound binds to a specific form of MTSP9, the compound is
[48] (i) inhibits the activation of single-chain simogen forms of MTSP9;
[49] (ii) inhibits the activity of the double- or single-chain form; And
[50] (iii) by further determining whether one or more of the properties inhibiting dimerization of the protein is exhibited, a method is provided for identifying a compound that binds to the single or double stranded form of MTSP9:
[51] The form may be in full length or truncated form, including cleavage at the activation site (between amino acids R ₁₈₅ and I ₁₈₆ ); Or protease domains derived from expression of a protease domain or catalytically active portion thereof.
[52] Provided herein are pharmaceutical compositions containing a protease domain and / or a full length or other domain of a MTSP9 polypeptide in a pharmaceutically acceptable carrier or excipient.
[53] Also provided are products containing the MTSP9 polypeptide and the protease domain of MTSP9 in single-chain or activated form. a) packaging material; b) polypeptide (or nucleic acid encoding it), in particular its single-chain protease domain; And c) a label indicating that said product is for use in an assay for identifying activity modulators of MTSP9 polypeptide.
[54] a) protease domain in MTSP9 polypeptide or single-chain or double-stranded form; And b) a targeting agent linked directly or via a linker to the MTSP, the targeting agent comprising: i) affinity separation or purification of the conjugate, ii) attachment of the conjugate to the surface, iii) the conjugate Detection, or iv) promote targeted delivery to selected tissues or cells. Such conjugates may contain a number of agents linked thereto. The conjugate may be a chemical conjugate and may be a fusion protein. The targeting agent may be a protein or peptide fragment. Such protein or peptide fragments may comprise protein binding sequences, nucleic acid binding sequences, lipid binding sequences, polysaccharide binding sequences or metal binding sequences.
[55] Combinations are provided herein. Such combinations include a) an activity inhibitor of MTSP9; And b) anticancer treatment means or anticancer agents. The MTSP inhibitor and anticancer agent may be formulated in a single pharmaceutical composition or each may be formulated in a separate pharmaceutical composition. The MTSP9 inhibitor may be an antibody against a fragment or binding portion thereof, such as an antibody that specifically binds a protease domain, an inhibitor of MTSP9 production, or an MTSP9 membrane-localization inhibitor or an MTSP9 activation inhibitor. Other MTSP9 inhibitors include MTSP9, in particular antisense nucleic acids or double-stranded RNA (dsRNA) encoding protease domain portions, such as RNAi; Nucleic acid encoding at least a portion of a gene encoding MTSP9, wherein the heterologous nucleotide sequence is inserted to inactivate the MTSP9 encoded heterologous sequence or a gene encoding the heterologous sequence, is not limited thereto. For example, a portion of the gene encoding MTSP9 can be flanked with heterologous sequences to enhance homologous recombination with genomic genes encoding MTSP9.
[56] Also provided is a method of treating or preventing a tumor or cancer in a mammal by administering to the mammal an effective amount of an MTSP9 inhibitor. MTSP9 inhibitors used for treatment or prophylaxis are administered with a pharmaceutically acceptable carrier or excipient. The mammal to be treated may be a human. The method of treatment or prophylaxis may further comprise administering an anticancer therapeutic means or anticancer agent, concurrently with, or after, or prior to administration of the MTSP9 inhibitor.
[57] Also provided are transgenic non-human animals that carry inactivation genes encoding MTSP and which carry genes encoding MTSP9 under non-natural promoter control. Such animals are useful for animal models of tumor initiation, growth and / or progression. Further provided herein are transgenic non-human animals containing heterologous nucleic acid MTSP9, which are in particular under the control of natural, non-natural promoters or present on exogenous elements such as plasmids or artificial chromosomes. In particular, the MTSP9 gene is not a natural promoter of such a gene or is under the control of a promoter that is not a natural promoter of a gene in a non-human animal, or the nucleic acid encoding MTSP9 is heterologous to a non-human animal and the promoter is a natural promoter or Provided herein are recombinant non-human animals that are non-natural promoters or in which MTSP9 is present on extrachromosomal elements, such as plasmids or artificial chromosomes. Recombinant and transgenic animals can be prepared by homologous recombination and non-homologous recombination methods.
[58] Gene therapy is provided. Provided herein are such methods performed by administering an inactivated form of MTSP9 in vivo or ex vivo, or by administering an MTSP-encoding nucleic acid molecule.
[59] In addition, treatment of the tumor by administering a prodrug activated by MTSP9 expressed or active in tumor cells, in particular a prodrug whose functional activity in tumor cells is greater than the functional activity in non-tumor cells A method is provided. When the prodrug is administered, the active MTSP9 expressed on the cell upon administration cleaves this prodrug to release the active drug near the tumor cells. These active anticancer drugs accumulate near the tumor. This is especially useful when MTSP9 is expressed in higher amounts, at higher levels, or significantly expressed or active in tumor cells compared to other cells.
[60] In addition, obtaining a biological sample from the subject; By exposing this to a detectable agent that binds to the double-stranded and / or single-stranded forms of MTSP9, precancerous lesions, malignancies or other pathological diseases in the subject (these pathological disorders may be A method of diagnosing the presence of a patient is provided.
[61] By administering an agent that inhibits the activation of activated or activated forms of the zymogen form of MTSP9, a method of inhibiting tumor invasion or metastasis or treating malignant or precancerous diseases is provided. Such diseases include, but are not limited to, diseases such as breast, cervical, prostate, lung, ovarian or colon tumors.
[2] Provided herein are proteases and portions thereof, particularly nucleic acid molecules encoding protease domains. Also provided herein are methods of prognosis, diagnosis, and treatment using the proteases and domains thereof, and nucleic acid molecules encoding them.
[62] A. Definition
[63] Unless stated otherwise, all technical and scientific terms used herein have the same meaning as commonly recognized by one of ordinary skill in the art to which this invention belongs. Unless otherwise stated, all patents, patent applications, publications, publications, GenBank sequences, websites, and other publications mentioned throughout this specification are hereby incorporated by reference in their entirety. Where there are several definitions for terms herein, the definitions in this section are widely used. When referring to a URL or other identifier or address, it should be recognized that such identifiers may change and certain information on the Internet may be changed, but equivalent information may be found by searching this Internet. Reference to this proves that this information is available and widely disseminated publicly.
[64] Abbreviations for all protecting groups, amino acids and other compounds as used herein, unless otherwise stated, the IUPAC-IUB Committee for their conventional usage, approved abbreviation definitions, or biochemical nomenclature [see (1972) Biochem. 11: 942-944.
[65] Serine proteases as used herein refer to a variety of protease families in which serine residues are involved in the hydrolysis of a protein or peptide. Such serine residues may be part of a catalytic triad mechanism involving serine, histidine and aspartic acid in the catalysis, or hydroxyl / ε-amine or hydroxyl / α- in which serine and lysine are involved in the catalysis It may be part of an amine catalytic dyad mechanism. Of particular interest are SPs of mammalian (including human) origin. Those skilled in the art generally recognize that single amino acid substitutions in non-essential regions of a polypeptide do not substantially change biological activity. Watson et al. (1987) Molecular Biology of the Gene, 4th Edition, The Bejacmin / Cummings Pub. co., p. 224].
[66] As used herein, “transmembrane serine protease (MTSP)” refers to a specific family of transmembrane serine proteases that share common structural features as referred to herein. Hooper et al. (2001) J. Biol. Chem. 276: 857-860. Thus, for example, reference to "MTSP" includes, but is not limited to, equivalent molecules obtained from MTSP3, MTSP4, MTSP6, MTSP7, or any other source, prepared synthetically, or exhibiting the same activity. It encompasses all proteins encoded by the MTSP gene family. Other MTSPs include, but are not limited to, choline, entereptidase, human airway trypsin-like protease (HAT), MTSP1, TMPRSS2, and TMPRSS4. Sequences of coding nucleic acid molecules of exemplary MTSPs and / or domains thereof, and encoded amino acid sequences, are described, for example, in US Patent Application Serial Nos. 09 / 776,191 (SEQ ID NOS: 1-12, 49, 50, and 61-72; PCT Corresponding to International Publication WO 01/57194. The term also encompasses MTSPs having amino acid substituents that do not substantially change the activity of each member. Suitable substitutions, including, but not necessarily, conservative substitutions of amino acids, are known to those skilled in the art and can be performed without removing the biological activity, eg, catalytic activity, of the resulting molecule.
[67] MTSP9, as used herein, whenever referred to herein,
[68] A polypeptide encoded by a nucleotide sequence comprising a sequence of nucleotides set forth in SEQ ID NO: 17 or nucleotides encoding amino acids 11-232 of SEQ ID NO: 6;
[69] A polypeptide encoded by a nucleotide sequence which hybridizes under low, moderate or high stringent conditions to nucleotide 31-729 of SEQ ID NO: 5 or to the nucleotide sequence set forth in SEQ ID NO: 17;
[70] A polypeptide comprising the sequence of amino acids set forth in amino acids 11-232 of SEQ ID NO: 6;
[71] About 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86% of the amino acid sequence set forth in SEQ ID NO: 17 or 18, or amino acids 11-232 of SEQ ID NO: 6 At least 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% Polypeptides; And / or
[72] One or more or all combinations of polypeptides encoded by the splice variant of MTSP9 set forth in SEQ ID NO: 17.
[73] In particular, MTSP9 polypeptides having the protease domains set forth in SEQ ID NOs: 5, 6, 16, 17 and 18 are provided. Polypeptides are single- or double-stranded polypeptides. Also provided are smaller portions thereof that retain protease activity. The protease domain of MTSP varies in composition and size, including deletions and insertions in surface loops. These are at least one active site three member (see also the catalytic three members of MTSP9 of SEQ ID NO: 18 are H ₂₂₇ , D ₂₇₂ and S ₃₆₈ ), primary specific pockets, oxyanion holes and / or other of the serine protease domain of the protease. It retains its preserved structure, including features. Thus, for the purposes of the present application, the protease domain is a specific part of the MTSP as defined herein, which is the domain of other MTSPs, eg, choline, entereptidase, human airway trypsin-like protease as identified above ( HAT), MTSP1, TMPRESS2 and TMPRSS4 are homologous; However, it has not been confirmed that the isolated single-chain form of the protease domain can function proteolytically in in vitro assays. With a larger class of chymotrypsin (S1) folds (see, eg, the Internet accessible MEROPS database), the MTSP protease domain shares a high level of amino acid identity. His, Asp and Ser residues required for activity are present in the conserved motifs. The activating site, which produces the N-terminus of the secondary chain in double strand form, has a conservative motif, which can be easily identified.
[74] MTSP9 can be of any animal, especially a mammal, and includes, but is not limited to, humans, rodents, poultry, ruminants and other animals. All domains thereof are contemplated, including full length simogen or double stranded activated forms, or protease domains which may be double stranded activated forms or single stranded forms.
[75] As used herein, "protease domain of MTSP" refers to a domain of MTSP that exhibits proteolytic activity and shares homology and structural features with the chymotrypsin / trypsin family protease domain. Thus, this is at least the minimum portion of the domain that exhibits proteolytic activity as assessed by standard in vitro assays. Such protease domains and catalytically active portions thereof are contemplated herein. Also provided are truncated forms of the protease domain, including the smallest fragment thereof which acts catalytically as a single chain form.
[76] Whenever the protease domain of MTSP9 is referred to herein,
[77] A polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 16;
[78] A polypeptide encoded by a nucleotide sequence which hybridizes under low, moderate or high stringent conditions to the nucleotide sequence set forth in SEQ ID NO: 15 or 17;
[79] A polypeptide comprising a sequence of the amino acid set forth in SEQ ID NO: 6, 16 or 18;
[80] About 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88% of the amino acid sequence set forth in SEQ ID NO: 6, 16 or 18; A polypeptide comprising an amino acid sequence representing at least 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or about 99% identical sequences; And / or
[81] One or more or all combinations or catalytically active portions of the protease domain of a polypeptide encoded by a splice variant of MTSP9.
[82] The protease domain of MTSP varies in construction and size, including deletions and insertions in the surface loops. They retain one or more active site ternaries, including primary specific pockets, oxyanion holes, and / or other features of the serine protease domain of the protease. Thus, for purposes herein, the protease domain is part of the MTSP as defined herein, which is homologous to the domain of other MTSPs. With a larger class of chymotrypsin (S1) folds (see, eg, the Internet accessible MEROPS database), the MTSP protease domain shares a high level of amino acid identity. His, Asp and Ser residues required for activity are present in the conserved motifs. The activating site (the cleavage thereof results in the N-terminus of the double-stranded protease domain) has a conservative motif, which can be easily identified.
[83] An active form refers to an active form in vivo and / or in vitro. Protease domains as used herein may also exist as a double stranded form. At least in vitro, it is shown herein that the single-chain form of the SP and its catalytic domain or proteolytically active portion (typically its C-terminal cleavage) exhibit protease activity. Accordingly, provided herein are isolated single-chain forms of the protease domain of SP, and their use in in vitro drug screening assays for identifying agents that modulate their activity.
[84] As used herein, the catalytically active domain of MTSP refers to the protease domain. In general, the protease domain of MTSP refers to the single chain form of a protein. If a double stranded form or both forms are intended, it is also specified as such. The simogen form of each protein is a single strand, which is converted to the active double strand form by activating cleavage.
[85] Activation cleavage as used herein refers to cleavage of the protease at the N-terminus of the protease domain (in this case, cleavage between R ₁₈₅ and L ₁₈₆ ; see SEQ ID NOs: 12 and 13). Upon cleavage through Cys-Cys pairing between the outer Cys of the protease domain (in this case C ₁₇₅ ) and the inside of the protein domain Cys (in this case Cys ₂₉₂ ), the resulting polypeptide has two chains (protease domain “A "Chain" and "B" chain). Cleavage can be performed by another protease or autocatalytically.
[86] The double stranded form of the protease as used herein is a double stranded form formed from the double stranded form of a protease that has formed a Cys pairing between Cys ₁₇₅ and Cys ₂₉₂ , linking the protease domain to the "A" chain, the remainder of the polypeptide. Refers to. The double-stranded protease domain form refers to both "rest of the polypeptide", ie, "A" chains that are shorter and contain only at least Cys ₁₇₅ .
[87] MTSPs of interest include those that are activated and / or expressed in tumor cells at different levels, typically higher than non-tumor cells; And those derived from cells wherein the substrate for tumor cells in tumor cells is different from the substrate in non-tumor cells, or is different for substrates, cofactors or receptors or changes the activity or specificity of MTSP.
[88] Human proteins, as used herein, are encoded by nucleic acids (eg, DNA) present in the human genome, including all allelic and conservative variants, except for those found in other mammals. It is.
[89] As used herein, “nucleic acid encoding a protease domain of SP or a catalytically active portion thereof” should be considered to refer to a single-stranded protease domain or nucleic acid encoding only the active portion thereof, and as a continuous sequence of SP It does not encrypt other adjacent parts.
[90] Catalytic activity as used herein refers to the activity of SP as a serine protease. The function of SP refers to its function in tumor biology, including its relevance to or initiation of, growth or progression of tumors, which is also involved in signal transformation. Catalytic activity refers to the activity of SP as a protease as assessed in an in vitro proteolytic assay that detects proteolysis of a selected substrate.
[91] As used herein, simogen is an inactive precursor of proteolytic enzymes. Such precursors are generally, but not necessarily, larger than the active form. With reference to serine proteases, the simogen is converted into active enzymes by specific cleavage, including catalytic and autocatalytic cleavage, or by binding of activating cofactors to produce mature active enzymes. Thus, simogen is an enzymatically inactive protein that is converted to proteolytic enzymes by the action of an activator.
[92] As used herein, “disease or disorder” refers to a pathological disease of an organism that originates, for example, from an infection or genetic defect and which is characterized by an acceptable level of symptoms.
[93] Neoplasia as used herein refers to abnormal new growth and therefore means the same as the tumor, which may be benign or malignant. Unlike hyperplasia, neoplastic proliferation persists even in the absence of intact stimulation.
[94] Neoplastic disease as used herein refers to any disorder associated with cancer, including tumor development, growth, metastasis and progression.
[95] Cancer as used herein refers to the general term for diseases caused by all types of malignant tumors.
[96] As used herein, malignant as applied to a tumor refers to a primary tumor that exhibits metastatic capacity while losing growth control and positional control.
[97] As used herein, anticancer agents (which are used interchangeably with "antitumor or antineoplastic agents") refer to all agents used for anticancer treatment. These, when used alone or in combination with other compounds, alleviate, reduce, ameliorate or prevent diagnostic markers or clinical symptoms associated with neoplastic diseases, tumors and cancers, or provide a relief state of these symptoms. Or all agents that can be maintained and that can be used in the methods, combinations and compositions provided herein. Non-limiting examples of anti-neoplastic agents include anti-angiogenic agents, alkylating agents, anti-metabolites, certain natural products, platinum coordination complexes, anthracendions, substituted ureas, methylhydrazine derivatives, adrenal cortex inhibitors, certain hormones, antagonists And anticancer polysaccharides.
[98] Splice variants as used herein refer to variants produced by differential processing of primary transcripts of genomic nucleic acids such as DNA that result in one or more mRNA types. Splice variants of the SP are provided herein.
[99] Angiogenesis as used herein broadly encompasses the entire process of directly or indirectly involved in the establishment and maintenance of new vascular systems (angiogenesis), including but not limited to angiogenesis associated with tumors. do.
[100] As used herein, anti-angiogenic treatment means or anti-angiogenic agents, when used alone or in combination with other therapeutic means or compounds, are associated with undesirable and / or uncontrollable angiogenic processes. It refers to all therapeutic regimens and compounds that can alleviate, reduce, ameliorate or prevent a clinical marker or clinical symptom, or provide or maintain a remission of these symptoms. Thus, for purposes herein, anti-angiogenic agents refer to agents that inhibit the fixation or maintenance of the vascular system. Such agents include, but are not limited to, antitumor agents and agents for the treatment of other disorders associated with undesirable angiogenic processes such as diabetic retinopathy, recurrent stenosis, hyperproliferative disorders, and the like.
[101] As used herein, an anti-tumor agent that is not an anti-angiogenic agent refers to an anti-tumor agent that does not act primarily by inhibiting angiogenic processes.
[102] Angiogenesis promoters as used herein are agents that enhance the fixation or maintenance of the vascular system. Such agents include agents for the treatment of cardiovascular disorders, including heart attacks and strokes.
[103] Undesired and / or uncontrollable angiogenesis process as used herein refers to a pathological angiogenesis process in which the effects of angiogenic process stimulators outweigh the effects of angiogenesis inhibitors. As used herein, a deficiency angiogenesis process refers to a pathological angiogenesis process associated with a defect in normal angiogenesis resulting in an abnormal angiogenesis process or a disorder in which there is no or substantial reduction in angiogenesis process.
[104] As used herein, the protease domain of an SP protein refers to the protease domain of SP that exhibits proteolytic activity. Thus, this is at least the minimum portion of the protein that exhibits proteolytic activity as assessed by standard in vitro assays. It refers herein to the single stranded form as well as to the double stranded activating form, where the double stranded form is intended as such. Examples of protease domains include portions of the sequence of amino acids set forth in SEQ ID NO: 6, encoded by the nucleotides of SEQ ID NO: 5, at least sufficient to exhibit protease activity.
[105] In addition, in vitro proteolytic assays show proteolytic activity and show about 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, of the full-length protease domain of the MTSP9 polypeptide, A polypeptide having at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or about 99% identical sequence, or Nucleic acid molecules encoding polypeptides that hybridize with nucleic acids encoding protease domains along their full length or along at least about 70%, 80% or 90% of such full length, especially under moderate, generally high stringent conditions Is considered.
[106] For protease domains, residues at the N-terminus may be critical for activity. The protease domain in the single-chain form of the MTSP9 protease is shown herein as catalytically active. Thus, protease domains generally require N-terminal amino acids for their activity; The C-terminal part can be cut. The amount that can be removed can be determined experimentally by testing the polypeptide for assay for protease activity in an in vitro assay that evaluates catalytic cleavage.
[107] Thus, smaller portions of the protease domain, in particular single chain domains, which retain protease activity are contemplated. Such smaller modifications are C-terminal truncated modifications of the protease domain. Protease domains vary in composition and size, including deletions and inserts in the surface loops. Such domains exhibit one or more structural features such as conservative structures including active site three members, primary specific pockets, oxyanion holes and / or other features of the serine protease domain of the protease. Thus, for the purposes of the present application, the protease domain is the Japanese chain portion of MTSP9 as defined herein, but it remains a sequence that is similar or homologous to the protease domain of chymotrypsin or trypsin and is homologous in its structural features. The polypeptide exhibits proteolytic activity as a single chain.
[108] Homologous as used herein means that the nucleic acid sequence identity is at least about 25%, for example 25%, 40%, 60%, 70%, 80%, 90% or 95%. If necessary,% homology will be specified. The terms "homology" and "identity" are often used interchangeably. In general, sequences are aligned such that the highest order match is obtained. Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H.G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; Carillo et al. (1988) SIAM J Applied Math 48: 1073. By sequence identity, the number of conserved amino acids is determined by the standard alignment algorithm program and used together with the default gap penalty established by each supplier. Substantially homologous nucleic acid molecules will hybridize, typically under moderately stringent or highly stringent conditions, along the full length of the nucleic acid molecule of interest or along about 70%, 80% or 90% of this full length. Also contemplated are nucleic acid molecules that contain degenerate codons instead of codons within such nucleic acid molecules that hybridize.
[109] Whether any two nucleic acid molecules have, for example, at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% “identical” nucleotide sequences, for example , Pearson et al. (1988) Proc. Natl. Acad. Sci. Using default parameters as in USA 85: 2444], this can be determined using known computer algorithms, such as the "FAST A" program (other programs include GCG program packages (Devereus, J. et al., Nucleic). Acids Research 12 (1): 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, SF, et al., J Molec Biol 215: 403 (1990); Guide to Huge Computers, Martin J. Bishop, ed , Academic Press, San Diego, 1994, and Carillo et al. (1988) SIAM J Applied Math 48: 1073). For example, the identity can be determined using the BLAST function of the National Center for Biotechnology Information. Other commercial or publicly available programs include the DNAStar "MegAlign" program (Madison, WI) and the University of Wisconsin's Genetics Computer Group (UWG) "Gap" program (Madison WI). The% homology or% identity of a protein and / or nucleic acid molecule can be determined by comparing the sequence information, for example using a GAP computer program. Needleman et al. (1970) J. Mol. Biol. 48: 443, as revised by Smith and Waterman ((1981) Adv. Appl. Math. 2: 482) .In short, the GAP program uses similar aligned symbols divided by the total number of symbols in the shorter of the two sequences. (Ie, nucleotides or amino acids) is defined as similarity The default parameters for the GAP program are: (1) Schwartz and Dayhoff, eds., ATLAS OF PROTEIN SEQUENCE AND STRUCTURE, National Biomedical Research Foundation, pp. 353-358 (1979), the weighted comparison matrix and unary comparison matrix (Gribskov et al. (1986) Nucl.Acids Res. 14: 6745) contain a value of 1 for identity and non- Contains a value of 0 for identity; (2) a penalty of 3.0 for each gap, and an additional 0.10 penalty for each symbol within each gap; and (3) a penalty for the terminal gap. May not be included. The term "identity" as used in the original shows the comparison between the test polypeptide or a polynucleotide and a reference polypeptide or polynucleotide.
[110] As used herein, the term “at least 90% identical” refers to 90% to 99.99% percent identity based on the reference polypeptide. At least 90% identity is, for example, assuming that a reference polynucleotide is compared with a test polynucleotide 100 amino acids in length, for example, 10% or less (ie, 10 out of 100) amino acids in the test polypeptide differ from the reference polypeptide. To indicate the fact. Similar comparisons can be made between test polynucleotides and reference polynucleotides. This difference can be represented as a point mutation randomly distributed over the entire length of the amino acid sequence, or it can be one or more positions of varying lengths up to the maximum allowable length, eg, 10/100 amino acid differences (approximately 90% identity) Can be concentrated on. Differences are defined as nucleic acid or amino acid substitutions or deletions. At a level of homology or identity of at least about 85-90%, the result should be independent of the program and gap parameter sets; This high level of identity is often easy to assess without resorting to software.
[111] As used herein, a primer refers to an oligonucleotide containing two or more, typically three or more deoxyribonucleotides or ribonucleotides from which synthesis of the primer extension product can be initiated. Experimental conditions for carrying out the synthesis should include nucleoside triphosphate, and agents for polymerization and stretching, such as DNA polymerase, and suitable buffers, temperatures and pH.
[112] Animals as used herein include any animal, including but not limited to goats, cattle, deer, sheep, rodents, pigs, and humans. Non-human animals, except for humans, are contemplated herein. The SPs provided herein are derived from all sources, animals, plants, prokaryotes and fungi. Most MTSP9s are of human origin, including mammalian origin.
[113] Gene therapy as used herein includes the delivery of heterologous nucleic acid (eg, DNA) into specific cells, ie target cells, of a mammal, particularly a human, having a disorder or disease for which such therapy is desired. The nucleic acid (eg DNA) is introduced into a selected target cell in such a way that the heterologous nucleic acid (eg DNA) is expressed and thereby produces a therapeutic product encoded. On the other hand, the heterologous nucleic acid (eg, DNA) can mediate the expression of the DNA encoding the therapeutic product in a certain way, or a product (eg, direct or indirectly mediate the expression of the therapeutic product in a particular way) : Peptide or RNA) can be encoded. Gene therapy may also be used to deliver a nucleic acid encoding a gene product that replaces a defective gene or supplements a gene product produced by a cell or mammal into which the nucleic acid is introduced. The nucleic acid so introduced is a therapeutic compound, such as a growth factor inhibitor thereof, or a tumor necrosis factor or inhibitor thereof, which is not normally produced in a mammalian host or which is not produced in a therapeutically effective amount or at a therapeutically useful time. , For example, may encode a receptor for it. Said heterologous nucleic acid (eg, DNA) encoding a therapeutic product can be modified prior to introduction into the cells of a diseased host to enhance or change the product or its expression. Gene therapy may also include delivering an inhibitor or other regulator of gene expression.
[114] Heterologous nucleic acid as used herein alters the expression of endogenous nucleic acid (eg, DNA) by not being normally produced in vivo by the cells expressing it or by affecting transcription, translation or other controllable biochemical processes. Protein and nucleic acid (if DNA encodes RNA) that encodes or mediates the mediator. Heterologous nucleic acid (eg DNA) may also be referred to as foreign nucleic acid (eg DNA). Any nucleic acid (eg, DNA) that is recognized or deemed foreign to the cell expressing it by a person expressing it or is considered herein as a heterologous nucleic acid is included herein as a heterologous nucleic acid, and the heterologous nucleic acid includes an exogenously added nucleic acid which is also expressed inherently. . Examples of heterologous nucleic acids include nucleic acids encoding traceable marker proteins, such as proteins endowed with drug resistance; Nucleic acids encoding therapeutically effective substances such as anticancer agents, enzymes and hormones; And other types of proteins, such as nucleic acids encoding antibodies, such as DNA. Antibodies encoded by heterologous nucleic acids can be secreted or expressed on the surface of cells into which such heterologous nucleic acids have been introduced. Heterologous nucleic acid is generally not inherent in the cell into which it is introduced, but is obtained from another cell or prepared synthetically. Generally, but not necessarily, the nucleic acid encodes proteins and RNA that are not normally produced by the cell in which it is expressed.
[115] A therapeutically effective product as used herein is a product encoded by said nucleic acid, typically DNA, when introducing heterologous nucleic acid into a host, which is expressed to ameliorate or eliminate symptomatic symptoms of congenital or acquired disease, or Or treat the disease.
[116] As used herein, reference to a polypeptide consisting essentially of a protease domain means that only the SP portion of the polypeptide is the protease domain or catalytically active portion thereof. Such polypeptides may optionally include and will generally comprise additional non-SP-derived amino acid sequences.
[117] As used herein, a cancer or tumor therapeutic means or therapeutic agent, when used alone or in combination with other therapeutic means or compounds, alleviates, reduces diagnostic markers or clinical symptoms associated with a defective angiogenic process, It refers to any therapeutic regimen and / or compound that can ameliorate or prevent, or provide or maintain a remission of these symptoms.
[118] As used herein, a domain refers to a molecule, such as a protein or a specific portion of a nucleic acid encoding it, that is structurally and / or functionally distinct from other parts of the molecule of interest.
[119] Protease as used herein refers to an enzyme that catalyzes the hydrolysis of a protein or peptide. This includes the simogen form and its activated form. Specifically, the protease refers to all forms and specific forms will be specifically specified. For the purposes herein, protease domains include single- and double-stranded forms of the protease domain of the SP protein. In the case of MTSP9, the protease domain also includes single and double stranded forms of this protease domain.
[120] Nucleic acids as used herein include DNA, RNA and homologues thereof, including protein nucleic acids (PNAs) and mixtures thereof. The nucleic acid may be single stranded or double stranded. Single-stranded molecules are considered when referring to probes or primers optionally labeled with a detectable label, such as a fluorescent label or radiolabel. Such molecules are typically of a length such that their targets are statistically unique or low copy numbers (typically less than 5, typically less than 3) for probing or priming a particular library. In general, a probe or primer contains at least 14, 16 or 30 contiguous sequences identical or complementary to the gene of interest. Probes and primers can be 10, 20, 30, 50, 100 or more nucleic acids in length.
[121] As used herein, a nucleic acid encoding a fragment or portion of an SP refers to a nucleic acid that encodes only the mentioned fragment or portion of the SP and does not encode other contiguous portions of the SP.
[122] As used herein, linking heterologous nucleic acids to regulatory and effector sequences of nucleotides, such as promoters, enhancers, transcriptional and translational disruption sites, and other signal sequences, refers to such nucleic acids ( Eg, DNA) and the nucleotide sequence. For example, operatively linking heterologous DNA to a promoter refers to a physical correlation between such DNA and a promoter, where RNA polymerase specifically recognizes, binds to and transcribs the DNA within a reading frame. Transcription of the DNA is initiated from the promoter. Thus, operatively linked or operatively associated is functional with the regulatory and effector sequences of nucleic acids (eg DNA) and nucleotides, such as promoters, enhancers, transcriptional and translational disruption sites, and other signal sequences. Refer to correlation. For example, operatively linking DNA to a promoter refers to a physical and functional correlation between such DNA and a promoter, wherein the RNA polymerase specifically recognizes, binds to, and transcribs the DNA. Transcription of DNA is initiated from the promoter. In order to optimize expression and / or in vitro transcription, 5 clones of the clone are removed to eliminate any potential potentially inappropriate alternative translational initiation (ie, starting) codons or other sequences that may interfere or degrade expression at the transcriptional or translational level. 'It may be necessary to remove, add or change non-detoxified parts. On the other hand, consensus ribosomal binding sites are described in Kozak J. Biol. Chem. 266: 19867-19870 (1991) may be inserted just before the 5 'of the start codon, which may enhance expression. The desire (or necessity) of this modification can be determined experimentally.
[123] As used herein, with respect to antisense oligonucleotides, a sequence complementary to at least a portion of RNA is generally complementary enough to hybridize with RNA under moderate or high stringent conditions to form a stable duplex. Sequence, in the case of a double-stranded SP antisense nucleic acid, the single strand of the duplex DNA (dsDNA) can be tested or triplex formation can be assessed. The ability to hybridize depends on the degree of complementarity and the length of the antisense nucleic acid. In general, the longer the nucleic acid length to hybridize, the more base mismatch with the SP encoding RNA, which may still form and contain stable duplexes (or triplets). One skilled in the art can ascertain the degree of discrepancy that can be tolerated by using standard procedures to determine the melting point of the hybridized complex.
[124] For purposes herein, amino acid substitutions can be made in either the SP and its protease domain, provided that the resulting protein should exhibit protease activity. Contemplated amino acid substitutions include conservative substitutions that do not abrogate proteolytic activity, for example, substitutions as shown in Table 1. As used herein, substitutions that change the properties of the protein, such as removal of cleavage sites or other sites, are also contemplated, which substitutions are generally non-conservative, but can be readily performed by one skilled in the art. have.
[125] Suitable conservative substitutions of amino acids are known to those skilled in the art, which can generally be done without changing the biological activity of the resulting molecule, eg, enzyme activity. Those skilled in the art generally recognize that single amino acid substitutions in non-essential regions of a polypeptide do not substantially change biological activity. Watson et al. Molecular Biology of the Gene, 4th Edition, 1987, The Bejacmin / Cummings Pub. co., p. 224]. Also included within the definition are catalytically active fragments of SP, in particular single chain protease moieties. Conservative amino acid substitutions are made, for example, as set forth in Table 1 below:
[126] Initial residue Conservative substitutions Ala (A) Gly; Ser, Abu Arg (R) Lys, Orn Asn (N) Gln; His Cys (C) Ser Gln (Q) Asn Glu (E) Asp Gly (G) Ala; Pro HIs (H) Asn; Gln Ile (I) Leu; Val; Met; Nle; Nva Leu (L) Ile; Val; Met; Nle; Nv Lys (K) Arg; Gln; Glu Met (M) Leu; Tyr; Ile; Nle; Val Ornithine Lys; Arg Phe (F) Met; Leu; Tyr Ser (S) Thr Thr (T) Ser Trp (W) Tyr Tyr (Y) Trp; Phe Val (V) Ile; Leu; Met; Nle; Nv
[127] Other substitutions may also be acceptable, which may be determined experimentally or in accordance with known conservative substitutions.
[128] Abu, as used herein, is 2-aminobutyric acid and Orn is ornithine.
[129] As used herein, amino acids present in the various amino acid sequences presented herein are identified according to well known three letter or one letter abbreviations. Nucleotides present in various DNA fragments are named according to standard single letter names commonly used in the art.
[130] As used herein, probes or primers based on the nucleotide sequences described herein include 10, 14 or more, typically 16 or more contiguous sequences of nucleotides of SEQ ID NO: 5, and 30, 50 or Probes of more than 100 contiguous sequences are included. The length of the probe or primer for unique hybridization is a function of the complexity of the genome of interest.
[131] As used herein, ameliorating a particular disorder symptom by administering a particular pharmaceutical composition, whether permanent or temporary, persistent or temporary, refers to any symptom reduction that may be due to or associated with the administration of the composition. do.
[132] Antisense polynucleotide as used herein refers to a synthetic sequence of nucleotide bases complementary to mRNA or a sense strand of double stranded DNA. When the sense polynucleotide and the antisense polynucleotide are mixed under appropriate conditions, the two molecules are bound or hybridized. When these polynucleotides bind (hybridize) with mRNA, protein synthesis (detoxification) is inhibited. When these polynucleotides bind with double-stranded DNA, RNA synthesis (transcription) is inhibited. This translational and / or transcriptional inhibition inhibits the synthesis of the protein encoded by the sense chain. Antisense nucleic acid molecules are typically a sufficient number of nucleotides, typically 5 or more contiguous nucleotides, often 14, 16 or 30 contiguous nucleotides, or a nucleic acid molecule encoding a gene of interest, to specifically bind a target nucleic acid. For example, it contains a modified nucleotide complementary to the coding portion of the nucleic acid encoding the single-chain protease domain of the SP.
[133] As used herein, an array refers to a collection of elements (eg, antibodies) that contain three or more members. An addressable array is one in which the members of the array are identifiable by location on the solid phase support. Thus, in general, array members are immobilized in discrete identifiable positions on the surface of the solid phase.
[134] As used herein, an antibody, whether naturally or partially or fully synthetically, refers to an immunoglobulin, including all derivatives thereof that retain the specific binding ability of the antibody. Thus, antibodies include all proteins having a binding domain that is homologous or substantially homologous to an immunoglobulin binding domain. Antibodies include members of all immunoglobulin families, including IgG, IgM, IgA, IgD, and IgE.
[135] Antibody fragments as used herein refer to all antibody derivatives shorter than full length that retain at least a portion of the specific binding capacity of the full length antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab ', F (ab) ₂ , single chain Fvs (svFV), FV, dsFV diabodies and Fd fragments. The fragments can be linked together by multiple chains, for example by disulfide bridges. Antibody fragments generally contain at least about 50 amino acids, typically at least 200 amino acids.
[136] Fv antibody fragments as used herein consist of one variable light domain and one variable heavy domain (V _H ) linked by non-covalent interactions.
[137] As used herein, dsFV refers to Fv with engineered intermolecular disulfide bonds that stabilize V _H -V _L pairs.
[138] F (ab) ₂ fragments as used herein are antibody fragments generated by digesting immunoglobulins with pepsin at pH 4.0-4.5, which can be produced recombinantly to produce equivalent fragments.
[139] Fab fragments as used herein are antibody fragments generated by digesting immunoglobulins with papain, which can be produced recombinantly to produce equivalent fragments.
[140] ScFVs as used herein refers to antibody fragments containing the variable heavy (V _H ) and variable light (V _L ) covalently linked by polypeptide linkers in any order. The length of this linker is chosen such that the two variable domains are bridged without substantial interference. Linkers include (Gly-Ser) _n residues with several Glu or Lys residues dispersed throughout to increase solubility.
[141] Humanized antibodies as used herein refer to antibodies that have been modified to include the amino acid sequence of a human so as not to elicit an immune response when administered to a human. Methods of making such antibodies are known. For example, to prepare such antibodies, hybridomas or prokaryotic cells expressing monoclonal antibodies or E. coli. Eukaryotic cells, such as E. coli or CHO cells, are modified by recombinant DNA techniques to express antibodies in which the amino acid composition of the non-variable regions is based on human antibodies. Computer programs have been devised to identify these areas.
[142] Diabodies as used herein are dimeric scFVs; Diabodies typically have shorter peptide linkers than scFVs, which are generally dimerized.
[143] As used herein, production by recombinant means using recombinant DNA methods means using methods well known in the field of molecular biology to express proteins encoded by cloned DNA.
[144] As used herein, the term "evaluate" yields an absolute value for the activity of an SP or domain thereof present in a sample, and also determines an index, ratio, percentage, visible value or other value that indicates this activity level. In terms of obtaining, it means quantitatively and qualitatively determining. The assessment can be direct or indirect, and the chemical species actually detected need not be the proteolytic product itself, but can be, for example, a derivative thereof or some additional substance.
[145] Biological activity as used herein refers to the physiological response or in vivo activity of a compound that results from the in vivo administration of a compound, composition or other mixture. Thus, biological activity encompasses the therapeutic and pharmaceutical activities of the compounds, compositions and mixtures. Biological activity can be observed in in vitro systems designed to test or use such activity. Thus, for the purposes of the present application, the biological activity of luciferase is its oxygenase activity which generates light upon oxidation of the substrate.
[146] Functional activity, as used herein, refers to a polypeptide or portion thereof that exhibits one or more activities associated with a full length protein. Functional activity includes biological activity, catalytic or enzymatic activity, antigenicity (the ability to compete with or bind to a specific polypeptide to bind an anti-polypeptide antibody), immunogenicity, the ability to form multimers, receptors for the polypeptide or Ability to specifically bind a ligand is included, but is not limited thereto.
[147] Conjugate as used herein refers to a compound provided herein comprising at least one SP (including MTSP9), in particular its single chain protease domain, and at least one targeting agent. These conjugates include those produced as fusion proteins by recombinant means; Produced by chemical means such as chemical coupling through coupling to sulfhydryl groups; And other methods of linking one or more SPs or domains thereof to the targeting agent directly or indirectly through a linker.
[148] Targeting agents as used herein are all residues that allow a conjugate to specifically bind a cell surface receptor, such as a protein or an effective portion thereof, which can internalize the conjugate or SP portion thereof. Targeting agents also include, for example, friendly separation or purification of the conjugate; Attaching the conjugate to a specific surface; Or to promote or facilitate the detection of a conjugate or a complex containing such a conjugate.
[149] Antibody conjugates as used herein refer to conjugates wherein the targeting agent is an antibody.
[150] Derivatives or homologs of molecules as used herein refer to portions derived from modified forms of such molecules.
[151] As used herein, an effective amount of a compound for treating a particular disease is an amount sufficient to ameliorate the symptoms associated with the disease or to lower these symptoms in some way. Such amounts may be administered in a single dose or may be administered depending on the effective regime. The amount can cure the disease, but typically it is administered for the purpose of improving disease symptoms. It is necessary to administer repeatedly to achieve the desired symptom improvement.
[152] Equivalent, as used herein, when referring to two nucleic acid sequences, means that the two sequences in question encode the same amino acid sequence or equivalent protein. When an equivalent is used to refer to two proteins or peptides, it means that the amino acid substitutions (eg, as shown in Table 1 above) do not substantially alter the activity or function of the two proteins or peptides. Conservative changes are included, but are not limited thereto). Where equivalents refer to properties, these properties do not need to be present to the same degree (eg, two peptides may exhibit the same type of enzymatic activity at different levels), but such activity is typically nearly identical. . When the term complementary is used with reference to two nucleotide sequences, it means that the two nucleotide sequences can hybridize, typically exhibiting 25%, 15%, less than 5% or 0% mismatch on the opposing nucleotides. Means that. If necessary, the% of complementarity will be specified. Typically, two molecules are chosen such that they hybridize under highly stringent conditions.
[153] As used herein, agents that modulate the activity of a protein or expression of a gene or nucleic acid reduce or increase or change the activity of the protein, or in some ways, upregulate the expression of the nucleic acid in a cell or Down adjust or change.
[154] As used herein, inhibitors of activity of an SP include any substance that inhibits or reduces the production, post-translational modification (s), mutation or membrane localization of the SP; Or in vitro screening assays encompasses all substances that reduce or interfere with the proteolytic potency of SP, particularly its single-chain form.
[155] As used herein, methods of treating or preventing neoplastic diseases reduce, ameliorate or prevent all symptoms that appear as characteristic of such diseases, such as tumors, their metastases, vascularization of tumors or other parameters. Or to provide or maintain a relief state of such symptoms. This also means that the salient features of neoplastic disease and metastasis can be eliminated, reduced or prevented by the treatment. Non-limiting examples of such salient features are that the basement membrane and the proximal extracellular matrix degrade to uncontrollable levels; Endothelial cells migrate, divide and organize into newly acting capillaries; This new acting capillaries will be permanent.
[156] Pharmaceutically acceptable salts, esters or other derivatives of the conjugates as used herein can be readily prepared by those skilled in the art using known methods for such derivatization and can be used in animals or animals without exhibiting substantial toxic effects. All salts, esters or derivatives which can be administered to a human and produce a pharmaceutically active or prodrug compound are included.
[157] As used herein, a prodrug is a compound that, upon in vivo administration, is metabolized or converted into a biological, pharmaceutical or therapeutically active form. To prepare a prodrug, the pharmaceutically active compound is modified to regenerate by metabolic processes. Such prodrugs can be designed to alter the metabolic stability or transport characteristics of a drug, to mask side effects or toxicity, to enhance the aroma of a drug, or to change other characteristics or properties of a drug. Using knowledge of in vivo drug metabolism and pharmacodynamic processes, one skilled in the art can devise prodrugs of such compounds if known pharmaceutically active compounds are known. Nogrady (1985) Medicinal Chemistry A Biochemical Approach, Oxford University Press, New York, pages 388-392.
[158] As used herein, a drug identified by the screening method provided herein refers to any candidate compound for use as a therapeutic agent or as a lead compound for the design of the therapeutic agent. Such compounds are small molecules (including small organic molecules), peptides, peptide mimetics, antisense molecules or dsRNAs such as RNAi, antibodies, antibody fragments, recombinant antibodies, and other compounds that may serve as drug candidates or leader compounds. Can be.
[159] Peptide-mimetics as used herein are compounds that mimic the stereostructure of certain biologically active forms of certain peptides and certain stereochemical characteristics. In general, peptide- mimetics are designed to mimic certain desirable properties of a compound, but not to mimic undesirable properties that cause loss of biologically active conformation and breakage of bonds. Peptide-mimetics can be prepared from biologically active compounds by replacing certain groups or bonds that cause undesirable properties with bioisostere. Bioisosteres are known to those skilled in the art. For example, methylene bioisostere CH ₂ S has been used as an amide substitute in enkephalin homologues. Spatola (1983) pp. 267-357 in Chemistry and BIochemistry of Amino Acids, Peptides, and Proteins, Weistein, Ed. volume 7, Marcel Dekker, New York. Morphine that can be administered orally is a compound that is a peptide- mimetic of the peptide endorphin. For the purposes herein, cyclic peptides are included in the peptide- mimetics.
[160] Promoter region or promoter element as used herein refers to a segment of DNA or RNA that controls the transcription of DNA or RNA operably linked thereto. The promoter region contains specific sequences sufficient for RNA polymerase recognition, binding and transcription initiation. The promoter region portion is referred to as a promoter. In addition, the promoter region includes sequences that regulate the recognition, binding and transcription initiation activity of RNA polymerase. These sequences may be cis functional or may be reactive with trans functional factors. Promoters can be either constitutive or regulated, depending on the regulatory nature. Examples of promoters contemplated for use in prokaryotes include bacteriophage T7 and T3 promoters.
[161] Receptor as used herein refers to a molecule that exhibits affinity for a given ligand. The receptor can be a natural or synthetic molecule. Receptors may also be referred to in the art as anti-ligands. Receptors and anti-ligands as used herein are interchangeable. Receptors can be used in their unchanged state or as aggregates with other species. Receptors can be attached to binding members by covalent or non-covalent or physical contact, which can be done directly or indirectly through specific binding agents or linkers. Examples of receptors include antibodies, membrane receptors, surface receptors and internalization receptors, monoclonal antibodies and antisera, drugs, polynucleotides, nucleic acids, peptides that are reactive with specific antigenic determinants (eg, on viruses, cells or other materials). , Cofactors, lectins, sugars, polysaccharides, cells, cellular membranes, and organelles.
[162] Receptors and fields of application using such receptors include, but are not limited to:
[163] a) enzymes: specific transport proteins or enzymes essential for the survival of microorganisms, which may serve as targets for antibiotic [ligand] selection;
[164] b) antibodies: can be investigated to identify ligand-binding sites on antibody molecules that bind epitopes of the antigen of interest; By determining a sequence that mimics an antigenic epitope, an immunogen thereof may develop a vaccine based on one or more of these sequences or develop a compound or related diagnostic agent useful for treatment, such as for the treatment of autoimmune diseases;
[165] c) nucleic acid: identification of a ligand (eg protein or RNA) binding site;
[166] d) catalytic polypeptides: polymers (including polypeptides) capable of enhancing chemical reactions involved in converting one or more reactants into one or more products; Such polypeptides generally include binding sites specific for one or more reactants or reaction intermediates, and active functional groups proximate such binding sites, which can chemically modify the bound reactants [US Pat. No. 5,215,899]. Reference);
[167] e) Hormone Receptors: Determining ligands that bind the receptor with high affinity is useful for developing hormone replacement therapy; For example, by identifying ligands that bind to these receptors, drugs can be developed that control blood pressure;
[168] f) Opiate receptors: Determining ligands that bind to opiate receptors in the brain is useful for developing alternatives that are less toxic to morphine and related drugs.
[169] As used herein, a sample refers to anything in which an analyte assay can contain the desired analyte. Such a sample may be a biological sample, eg, biological fluids or biological tissue. Examples of biological fluids include urine, blood, plasma, serum, saliva, semen, feces, phlegm, cerebrospinal fluid, tears, mucus, sperm and amniotic fluid. Biological tissue is usually a specific kind of cell aggregate with their intercellular material forming one of the structural materials of human, animal, plant, bacterial, fungal or viral structures (including connective, epithelial, muscle and neural tissues). to be. Examples of biological tissues include organs, tumors, lymph nodes, arteries and individual cell (s).
[170] As used herein, the stringency of hybridization in determining the mismatch rate is as follows:
[171] 1) High stringency: 0.1 x SSPE, 0.1% SDS, 65 ℃
[172] 2) Medium stringency: 0.2 x SSPE, 0.1% SDS, 50 ℃
[173] 3) Low stringency: 0.1 x SSPE, 0.1% SDS, 50 ° C.
[174] Those skilled in the art are known washing steps selected for stable hybrids and also components of SSPE are known. See Sambrook, EF Fritsch, T. Maniatis, in: Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989). ), vol, pB 13; See also numerous catalogs where commonly used experimental solutions have been reported. SSPE is pH 7.4 phosphate buffered 0.18 NaCl. In addition, those skilled in the art will appreciate that the stability of the hybrid is T _m [which is a function of sodium ion concentration and temperature (T _m = 81.5 ° C.-16.6 (log ₁₀ [Na ⁺ ]) + 0.41 (1% G + C) -600 / l). It is recognized that the only parameter in washing conditions critical to hybrid stability is the sodium concentration and temperature in the SSPE (or SSC).
[175] It should be appreciated that other buffers, salts, and temperatures may be used to achieve equivalent stringency. For example, but not limited to, the procedure using low stringent conditions is as follows. Shilo and Weinberg, Proc. Natl. Acad. Sci. USA 78: 6789-6792 (1981)]: Filter containing DNA for 6 hours at 40 ° C., 35% formamide, 5X SSC, 50 mM Tris-HCl, pH 7.5, 5 mM EDTA, 0.1% PVP, 0.1% Pretreated in a solution containing Ficoll, 1% BSA, and 500 μg / ml denatured salmon sperm DNA (10 × SSC is 0.15 M sodium citrate and 1.5 M sodium chloride adjusted to pH 7).
[176] Hybridization is performed in the same solution with the following modifications: 0.02% PVP, 0.02% Picol, 0.2% BSA, 100 μg / ml Salmon Sperm DNA, 10% (wt / vol) Dextran Sulfate, and 5-20 X 10 ⁶ cpm ³² P-labeled probes are used. The filter is incubated in the hybridization mixture at 40 ° C. for 18-20 hours and then washed for 1.5 h at 55 ° C. in a solution containing 2 × SSC, 25 mM Tris-HCl, pH 7.4, 5 mM EDTA and 0.1% SDS. . This wash solution is replaced with fresh solution and incubated further at 60 ° C. for 1.5 hours. The filter is blotted dry and exposed for self spinning. If necessary, the filter is washed three times at 65-68 ° C. and reexposed to the film. Other low stringent conditions that can be used are known in the art (eg, as used for cross-species hybridization).
[177] Examples of, but not limited to, the use of moderately stringent conditions include, but are not limited to, for example, the use of moderately stringent conditions such as: a filter containing DNA at 55 ° C. For 6 hours, pretreat in a solution containing 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 μg / ml denatured salmon sperm DNA. Hybridization is performed in the same solution and 5-20 × 10 ⁶ cpm ³² P-labeled probes are used. The filter is incubated in the hybridization mixture at 55 ° C. for 18-20 hours and then washed twice for 30 minutes at 60 ° C. in a solution containing 1 × SSC and 0.1% SDS. The filter is blotted dry and exposed for autoradiography. Other moderately stringent conditions that can be used are known in the art. Washing of the filter is carried out for 1 hour at 37 ° C. in a solution containing 2 × SSC, 0.1% SDS.
[178] For example, but not by way of limitation, the procedure using high stringent conditions is as follows: A filter containing DNA was run at 65 ° C. for 8 hours to overnight, 6 × SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA. Prehybridized in a buffer consisting of 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 μg / ml denatured salmon sperm DNA. The filter is hybridized for 48 hours at 65 ° C. in a prehybridized mixture containing 100 μg / ml denatured salmon sperm DNA and 5-20 × 10 ⁶ cpm of ³² P-labeled probe. Washing of the filter is carried out for 1 hour at 37 ° C. in a solution containing 2 × SSC, 0.01% PVT, 0.01% Ficoll and 0.01% BSA. It is then washed in 0.1X SSC at 50 ° C. for 45 minutes and then exposed by autoradiography. Other high stringent conditions that can be used are known in the art.
[179] The terms substantially the same, or substantially homologous or similar vary depending on the context of the perception of a person skilled in the art, which is generally at least 60% or 70%, preferably at least 80%, at least 85%, more preferably Preferably at least 90%, most preferably at least 95% identical.
[180] As used herein, substantially identical to a product means sufficiently similar so that the properties of interest do not sufficiently change so that the substantially identical product can be used in place of the product.
[181] As used herein, substantially pure refers to standard analytical methods such as thin layer chromatography (TLC), gel electrophoresis and high performance liquid chromatography (HPLC) that are used by those skilled in the art to assess purity. As determined by the homogeneous enough to not contain easily detectable impurities, or by further purification, the detectable levels of the physical and chemical properties of the substance, for example enzymatic and biological activity, are detectable. It is pure enough to not change. Methods for purifying compounds to produce substantially chemically pure compounds are known to those skilled in the art. However, the substantially chemically pure compound may be a stereoisomer or a mixture of isomers. In such cases, further purification may increase the specific activity of the compound.
[182] Target cell as used herein refers to a cell expressing SP in vivo.
[183] As used herein, a test substance (or test compound) is in a single-chain form comprising SP, in particular a protease domain or a moiety sufficient for its activity, as determined by in vitro methods, for example, the assays provided herein. Chemically defined compounds that are effective against, for example, organic molecules, inorganic molecules, organic / inorganic molecules, proteins, peptides, nucleic acids, oligonucleotides, lipids, polysaccharides, saccharides or hybrids, such as sugars Protein, etc.) or mixtures of compounds, such as libraries of test compounds, natural extracts, or culture supernatants.
[184] As used herein, the terms therapeutic, therapeutic regimen, radioprotective agent, chemotherapeutic agent means conventional drugs and drug therapies (including vaccines) known to those skilled in the art. Radiotherapy agents are well known in the art.
[185] By therapeutic means as used herein is meant any way in which the symptoms of a particular disease, disorder or disease are ameliorated or advantageously changed. The therapeutic means also encompasses all pharmaceutical uses of the compositions provided herein.
[186] As used herein, a vector (or plasmid) refers to a separate element used to introduce heterologous nucleic acid into a cell for its expression or replication. Vectors are typically maintained as episomes but can be designed to incorporate certain genes or portions thereof into the chromosomes of the genome. Also contemplated are vectors that are artificial chromosomes, such as yeast artificial chromosomes and mammalian artificial chromosomes. Selection and use of such vehicles are well known to those skilled in the art. Expression vectors include vectors capable of expressing DNA operably linked to regulatory sequences (eg, promoter regions) capable of expressing DNA fragments. Thus, expression vectors refer to recombinant DNA or RNA constructs, such as plasmids, phages, recombinant viruses or other vectors, which, upon introduction into a suitable host cell, result in expression of the cloned DNA. Suitable expression vectors are well known to those of ordinary skill in the art and include those capable of replicating in eukaryotic and / or prokaryotic cells and those that remain episomal or integrate into the host cell genome.
[187] Protein binding sequences as used herein refer to other protein or peptide sequences, generally a protein or peptide sequence set or a protein or peptide sequence capable of specifically binding to a particular protein or peptide sequence.
[188] Epitope tags as used herein refer to short stretches of amino acids corresponding to epitopes to facilitate subsequent biochemical and immunological analysis of epitope tagged proteins or peptides. Epitope tagging is accomplished by incorporating the epitope tag sequence for the protein-coding sequence into a suitable expression vector. Epitope tagged proteins can be affinity purified using highly specific antibodies generated against these tags.
[189] Metal binding sequence as used herein refers to a protein or peptide sequence capable of specifically binding to a metal ion, generally a set of metal ions or a particular metal ion.
[190] Combination as used herein refers to all associations between two or more items.
[191] Composition as used herein refers to all mixtures. It may be a solution, suspension, liquid, powder, paste, aqueous, non-aqueous or any combination thereof.
[192] Fluid as used herein refers to any composition that can flow. Thus, the fluid encompasses compositions in the form of semi-solids, pastes, solutions, aqueous mixtures, gels, lotions, creams, and other compositions.
[193] Cellular extracts as used herein refer to preparations or fractions prepared from lysed or disrupted cells.
[194] Agents as used herein are referred to as randomly selected when random agents are selected without considering the specific sequences involved in association with proteins alone or their associated substrates, binding partners, and the like. Examples of randomly selected agents are the use of chemical libraries or peptide combination libraries, or growth broths of organisms or conditioned media.
[195] Certain agents, as used herein, are referred to as being reasonably selected or designed when the agent is selected on a non-random basis in view of the target site sequence and / or conformation thereof in relation to the action of such agent. As described in this example, binding sites and (catalytic) sites for serine proteases are proposed in proteins having SEQ ID NO: 3 or SEQ ID NO: 4. By utilizing the peptide sequences constituting these sites, the agent can be reasonably selected or reasonably designed. For example, a reasonably selected peptide preparation may be a peptide whose amino acid sequence is the same as the ATP or calmodulin binding site or domain.
[196] Without being limited by this, for clarity, the detailed description is divided into the following subsections:
[197] B. MTSP9 polypeptides, muteins, derivatives and homologues thereof
[198] MTSP
[199] MTSP is a family of transmembrane serine proteases found in mammals and other species. MTSPs are of interest because they have different functional activities by being expressed and / or activated at different levels in tumor cells and normal cells, or by changes in their substrates or cofactors or receptors in tumor cells and normal cells.
[200] MTSPs share a number of common structural features, including: proteolytic extracellular C-terminal domains; A transmembrane domain with a hydrophobic domain near the N-terminus; Short cytoplasmic domains; And stem regions of various lengths that may contain additional module domains. Proteolytic domains share sequence homology including the conserved His, Asp, and Ser residues required for catalytic activity present in conserved motifs. These MTSPs are generally synthesized as simogens and can be activated in double-stranded form by cleavage. Since single-chain proteolytic domains can act in vitro, it is shown herein that they are useful in in vitro assays for identifying agents that modulate the activity of members of the family.
[201] For purposes herein, the protease domain of MTSP comprises a single-chain polypeptide, wherein the N-terminus comprises the consensus sequence ↓ VVGG, ↓ IVGG, ↓ VGLL, ↓ ILGG, ↓ IVQG or ↓ IVNG ↓ IASG, or other such motifs. It should not result from an activation cleavage that produces a double stranded activation product. Although not caused by activating cleavage and not in the double-stranded form, such polypeptides exhibit proteolytic (catalytic) activity. These protease domain polypeptides are used in assays to screen for agents that modulate the activity of MTSP9.
[202] The MTSP family is a target for therapeutic intervention, and some members may also serve as diagnostic markers for tumor development, growth and / or progression. As discussed, members of the family are involved in proteolytic processes that closely affect tumor development, growth and / or progression. This association is based on the fact that they act as in-process proteolytic enzymes in the activation of ECM degradation and / or remodeling and growth promoters, hormone promoting or angiogenic compounds. In addition, their expression level, or their apparent activity or activation level resulting from the substrate level or its substrate change level, are different from each other in tumor cells and non-tumor cells in the same tissue. Similarly, co-factor or receptor levels for these proteases may differ in tumor cells and non-tumor cells. Thus, for example, by contacting the member with a compound that modulates their activity and / or expression, altering their activity, eg, their proteolytic activity, and their role in signal transduction and / or expression. Protocols and treatments will affect tumor development, growth and / or progression. In addition, in some cases, activation and / or expression levels may vary in tumors such as lung carcinoma, colon adenocarcinoma and ovarian carcinoma.
[203] MTSP9
[204] MTSP9 is interesting because it is expressed or active in tumor cells. The MTSP provided herein can be used to diagnose specific tumors through the level of activity and / or expression or function in a subject with neoplastic disease (ie, a mammal, especially a human) as compared to the subject (s) without a neoplastic disease. Can act as a medical marker. In addition, the detection of activity (and / or expression) in specific tissues is an indication of the presence of neoplastic disease. Since MTSP9 provided herein is expressed and / or activated in certain tumors, it is presented herein that their activity or expression may act as a diagnostic marker for tumor development, growth and / or progression. In another example, the MTSP polypeptide may exhibit altered activity through changes in the activity or expression of co-factors, substrates or receptors. In addition, in some instances, these MTSPs and / or variants thereof may be secreted from the cell surface. The detection of MTSPs, in particular extracellular protease domains, in body fluids such as serum, blood, saliva, cerebrospinal fluid, synovial fluid and matrix fluids, urine, sweat and other body fluids and secretions can serve as diagnostic tumor markers. In particular, the detection of high levels of secreted polypeptide in a subject compared to a subject known to be free of any neoplastic disease or compared to an initial sample from the same subject indicates that the subject has a neoplastic disease.
[205] Polypeptides and Muteins
[206] Provided herein are isolated and substantially pure single- and double-stranded polypeptides containing the protease domain of MTSP9. In addition, the polypeptide may contain other non-MTSP sequences of amino acids, but includes a portion thereof sufficient to exhibit catalytic activity to assess such protease activity in the protease domain or in any in vitro assays.
[207] The MTSP9 polypeptides provided herein are typically expressed or activated in tumor cells at a different level than the level at which they are expressed or activated by non-tumor cells of the same type. Thus, for example, when MTSP is expressed in cervical tumor cells, it is expressed or active at a different level than in non-tumor cervical cells. Expression or activity of MTSP9 is an indicator of the cervix, lungs, esophagus, colon, prostate, uterus, pancreas, breast and other tumor cells.
[208] An isolated and substantially pure protease is provided comprising a protease domain or a catalytically active portion thereof. Single and double stranded forms of MTSP9 are provided. Such protease domains can be included in longer proteins, which longer proteins are optionally MTSP9 simogens. For example, the protein sequences of the MTSP9-encoding nucleic acid and protease domains are shown in SEQ ID NOs: 5 and 6, and the full length protein and coding nucleic acid sequences are shown in SEQ ID NOs: 18 and 17. Thus, the MTSP9 polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 6, 16 or 18. Smaller portions thereof that retain protease activity are contemplated. Its protease domain is shown in SEQ ID NO: 16.
[209] Substantially purified MTSP9 protease allows the protease domain encoding nucleic acid to hybridize along its full length or along at least about 70%, 80% or 90% of its full length, under at least moderate, generally high stringent conditions, Encoded by a nucleic acid that hybridizes with a nucleic acid molecule containing a protease domain encoded by the nucleotide sequence set forth in Nos. 5 and 17. In certain embodiments, the substantially purified MTSP protease is a single-chain polypeptide or protease domain portion thereof, or catalytically active portion thereof, substantially comprising the amino acid sequence set forth in SEQ ID NOs: 6, 18.
[210] Also included are substantially purified MTSP9 simogens, activated double stranded forms, single stranded protease domains and double stranded protease domains. These polypeptides comprise a sequence encoding a protease domain that exhibits proteolytic activity and are typically found in nucleic acid molecules having the nucleotide sequence set forth in SEQ ID NO: 5 or 7, under conditions of moderate, generally high stringency, the complete length of the protease domain. Or is encoded by a nucleic acid that hybridizes along at least about 70%, 80% or 90% (substantially full length) of the full length. Splice variants are also contemplated herein.
[211] Protease domain
[212] The MTSP protease domain includes the single chain protease domain of MTSP9. Any MTSP, in particular a protein or protease domain is provided that comprises a portion of MTSP that is the protease domain of MTSP9. Such proteins may also include other non-MTSP amino acid sequences, but include such protease domains, or are sufficient to exhibit catalytic activity in all in vitro assays to assess protease activity as provided herein. Include the part. Also provided are the double stranded activated forms of the full length protease and the double stranded forms of the protease domain.
[213] Thus, there is provided an isolated and substantially pure protease comprising the protease domain or catalytically active portion thereof as the single-chain form of SP. Such protease domains can be included in longer proteins, which longer proteins are optionally MTSP9 simogens.
[214] In particular, examples of protease domains include at least a sufficient portion of amino acids 206-438 set forth in SEQ ID NO: 16, encoded by the nucleotides of SEQ ID NO: 15 and SEQ ID NO: 17.
[215] As is well known, the protease domain of MTSP is characterized by the cleavage site (generally consensus sequence R ↓ VVGG, R ↓ IVGG, R ↓ IVQ, R ↓ IVNG, R ↓ ILGG, R ↓ VGLL, R ↓ ILGG or a variant thereof; single-chain polypeptide having an N-terminus (eg, IV, VV, IL and II) generated at the N-terminus R ↓ V or R ↓ I, where the arrow indicates a cleavage point; or Double-stranded polypeptides. An example protease domain of MTSP9 produced by activating cleavage between R ₁₈₅ and I ₁₈₆ (R ↓ I) comprises the sequence R ↓ IASG as set forth in SEQ ID NOs: 17 and 18.
[216] Muteins and derivatives
[217] Full length MTSP9, its simogens and activated forms, and MTSP9 protease domains, portions thereof, and muteins and derivatives of such polypeptides are provided. Domains, fragments, derivatives or homologues of functionally active MTSP9 may exhibit one or more functional activities associated with MTSP9, such as protease activity, immunogenicity and antigenicity.
[218] Such derivatives include rodents such as mice and rats; Poultry such as chicken; Ruminants such as goats, cattle, deer, sheep; Sheep animals such as pigs; And animal MTSP9, including but not limited to humans. For example, MTSP9 derivatives can be made by changing their sequence by substitution, addition or deletion. The MTSP9 derivative contains, as a primary amino acid sequence, all or part of the amino acid sequence of MTSP9 (which includes a sequence changed by replacing functionally equivalent amino acid residues with residues in the sequence of MTSP9 resulting in a silent change). But it is not limited thereto. For example, one or more amino acid residues in a sequence may be substituted with another amino acid of similar polarity which acts as a functional equivalent that results in a silent change. Substituents for amino acids in the sequences may be selected from other members of the class to which they belong. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine. Positively charged (basic) amino acids include arginine, lysine and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid (see Table 1). A mutein of MTSP9 or its substituting for replacing up to about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90% or 95% of an amino acid with another amino acid Domains, such as protease domains, are provided. Generally, these muteins have at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85% or 90% of the protease activity of the mutated protein. .
[219] About 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87% of amino acids A mutein of MTSP9 wherein up to 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% is substituted with another amino acid, or Domains thereof, such as protease domains, are provided. Typically these muteins retain the protease activity of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% unmutated protein.
[220] The polypeptides provided herein contain amino acid changes such that the MTSP9 protease domain, or specificity and protease activity is substantially unchanged, or is changed (increased or decreased) by a given percentage, for example, 10, 20, 30, 40, 50%. Having polypeptides are included. In particular, a substantially purified mammalian MTSP polypeptide having a transmembrane domain is provided and may further comprise a transmembrane (TM) domain, an SEA domain and a serine protease catalytic domain. Animal MTSP polypeptides are provided.
[221] MTSP9 and 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92 Substantially purified proteins are provided having at least%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical amino acid sequences, where% identity is consistent with standard algorithms that maximize% identity. Determined using gap penalty. Human MTSP9 polypeptides are included, but other mammalian MTSP9 polypeptides are also contemplated. The exact% identity can be specified if necessary.
[222] One or more Cys residues, especially those that form pairs in the activated double-chain form but do not form pairs in the prodease domain alone, may be any amino acid, but not necessarily, conservative amino acid residues such as Ser. Replaced muteins are considered. Disulfide bond pairing in MTSP9 is as follows: C ₁₇₅ -C ₂₉₂ , C ₂₁₂ -C ₂₂₈ , C ₃₃₇ -C ₃₅₃ , C ₃₆₄ -C ₃₉₃ . Cys ₂₉₂ is in the protease domain and is not paired with the single chain form of the protease domain. A mutein of MTSP9, in particular a Cys residue, for example Cys ₂₉₂ in a single-chain protease domain, is replaced with another amino acid, such as Ser, Gly or Ala, which does not remove its activity. Furthermore, about 60%, 70%, 75%, 80%, 81 and protease domains comprising the amino acid sequence set forth in SEQ ID NO: 16 or a catalytically active portion thereof or a protease and domain thereof comprising the amino acid sequence set forth in SEQ ID NO: 18 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, Substantially purified MTSP9 polypeptides and functional domains thereof are provided having at least 98% or 99% identical sequences.
[223] Also provided are muteins of proteins in which amino acids are replaced with other amino acids. These include, but not necessarily, muteins replaced by conserved amino acid residues, such as serine, typically but not necessarily. Such muteins are also provided herein. Replaces at least 10%, 20%, 30%, 35%, 40%, 45%, 50% or more of the amino acids, but the resulting polypeptide is an unmodified form for the same substrate, about 10%, 20 A mutein is provided having at least%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% or 95%.
[224] Muteins can be made by performing conservative amino acid substitutions and also non-conservative amino acid substitutions. For example, amino acid substitutions can be made that change the properties of the protein as desired. In one embodiment, mutations can be carried out to prevent degradation of the polypeptide. Because many proteases cleave basic residues, such as R and K, to eliminate such cleavage, the basic residues are replaced with non-basic residues. In addition, non-conservative changes in amino acids outside the protease domain can be performed without changing protease activity. Non-conservative changes in amino acids involved in activities other than protease activity may be desirable. For example, by performing non-conservative changes at the site where the inhibitor and protease interact, the interaction of the protease with the inhibitor can be retained while retaining catalytic activity. Similarly, by making non-conservative or conservative changes at the site where the protease interacts with the receptor, receptor binding can be changed without changing catalytic activity.
[225] Antigens containing 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 40, 50 or more, typically 10-15 amino acids of MTSP9 polypeptide Sex epitopes are provided. These antigenic epitopes are used, for example, to produce antibodies. Antibodies specific to each epitope or combination thereof and antibodies specific to single-chain and double-chain forms are provided.
[226] Expression of Nucleic Acid Molecules, Vectors and Plasmids, Cells, and MTSP9 Polypeptides
[227] Nucleic acid molecule
[228] Due to the degeneracy of the nucleotide coding sequence, other nucleic acid sequences that encode an amino acid sequence substantially identical to MTSP9 are contemplated. These include, but are not limited to, nucleic acid molecules comprising all or part of the MTSP9-coding gene, which result in a silent change by changing by substitution of different codons encoding amino acid residues in the sequence.
[229] Nucleic acid
[230] Also provided herein are nucleic acid molecules and encoded proteins that encode MTSP9 polypeptides. In particular, nucleic acid molecules encoding MTSP9 from animals, including splice variants thereof, are provided. The encoded protein is also provided. In addition, its functional domain is provided. For each nucleic acid molecule provided, the nucleic acid may be DNA or RNA or PNA or other nucleic acid homologues, or may comprise non-natural nucleotide bases. Also provided are isolated nucleic acid molecules comprising a nucleotide sequence complementary to the nucleotide sequence encoding MTSP.
[231] It also has proteolytic activity in in vitro proteolytic assays, and has about 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85% with the full-length protease domain of the MTSP9 polypeptide. At least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical or complete Japanese chains that hybridize with nucleic acids encoding protease domains along nucleic acids of length or along about 70%, 80% or 90% or more of this full length, especially under moderate, generally high stringent conditions Or double print Nucleic acid molecules encoding MTSP proteases are provided. As above, the encoded polypeptide contains a protease as single chain; An activated form thereof can be generated and provided.
[232] In one aspect, a nucleic acid molecule encoding an MTSP designated MTSP9 is provided. The nucleic acid molecule comprises an open reading frame of the nucleotide sequence set forth in SEQ ID NO: 17. Furthermore, at least under stringent, moderately stringent, and generally high stringent conditions, at least according to an open reading frame comprising a nucleotide encoding a nucleic acid sequence (SEQ ID NO: 5 or 17), in particular its single protease domain or any domain of MTSP9. Nucleic acid molecules that hybridize are provided.
[233] In certain embodiments, the isolated nucleic acid fragments hybridize under high stringent conditions to nucleic acids having the nucleotide sequence set forth in SEQ ID NO: 5 or 17, and generally contain the nucleotide sequence set forth in SEQ ID NO: 5 or 17. The protein contains a transmembrane domain (TM) and a serine protease domain.
[234] Also provided are muteins of nucleic acid molecules encoding polypeptides in which amino acids are replaced with other amino acids. Provided herein is that the Cys residue-coding codons in the mutein have been replaced with other amino acid residues, such as codon encoding serine. Each such domain provided herein is a nucleic acid molecule comprising a nucleotide sequence encoding such a domain. Some MTSPs may additionally include LDLR domains, scavenger-receptor cysteine rich (SRCR) domains, and other domains.
[235] An isolated nucleic acid fragment may be DNA (including genomic or cDNA) or RNA or other components, such as protein nucleic acids. An isolated nucleic acid may comprise additional components, such as heterologous or natural promoters, and other transcriptional and translational regulatory sequences, which genes may be other genes, such as reporter genes or other indicator genes, or instructions. Can be linked to a gene encoding a factor.
[236] Furthermore, under at least low stringency, moderate stringency and typically high stringency conditions, hybridization with the above-mentioned nucleotide sequence encoding MTSP9, and 70% of the protease domain of MTSP9 and / or its full length protein or full length Nucleic acid molecules are provided that encode at least 80% or 90% of protease domains or other domains, or splice variants or allelic variants thereof. In general, the molecule is hybridized under the conditions along the full length to at least one domain or along at least about 70%, 80% or 90% of the full length, and at least one domain of the polypeptide, such as a protease Encrypt the domain or extracellular domain. In particular, such nucleic acid molecules include (1) a nucleotide sequence encoding a protease or domain thereof, and (2) all isolated nucleic acid fragments encoding at least one domain of a membrane serine protease, selected from:
[237] (a) a nucleotide sequence encoding a protease or domain thereof comprising the nucleotide sequence set forth in SEQ ID NO: 15 or 17;
[238] (b) a nucleotide sequence encoding said partial or full length protease and hybridizing with nucleic acids complementary to mRNA transcripts present in mammalian cells, generally under high stringent conditions, encoding said protein or fragment thereof;
[239] (a) a nucleotide sequence encoding a protease or domain comprising a nucleotide sequence having at least about 60%, 70%, 80%, 90% or 95% identical sequence to the sequence set forth in SEQ ID NO: 5, 15 or 17;
[240] (c) a nucleotide sequence encoding a transmembrane protease or domain thereof comprising an amino acid sequence encoded by said partial or full length open reading frame;
[241] (d) a nucleotide sequence encoding a protease or domain comprising a nucleotide sequence having a sequence at least about 60%, 70%, 80%, 90% or 95% identical to the sequence set forth in SEQ ID NO: 5, 15 or 17;
[242] (d) a nucleotide sequence that encodes a transmembrane protease comprising an amino acid sequence encoded by the nucleotide sequence encoding the subunit and hybridizes with DNA complementary to the mRNA transcript under low, medium or high stringent conditions .
[243] An isolated nucleic acid may contain at least 10, 25, 50, 100, 150, or 200 contiguous nucleotides of the MTSP9-coding sequence or the full-length SP-coding sequence. In another embodiment, the nucleic acid may be less than 35, 200 or 500 nucleotides in length. Nucleic acids hybridized or complementary to MTSP9-encoding nucleic acid molecules may be single stranded or double stranded. For example, a nucleic acid comprising at least 10, 25, 50, 100, or 200 nucleotides of an MTSP9-encoding nucleic acid, or a sequence (specifically, its complement), complementary to its entire coding region, in particular its protease domain. This is provided. For MTSP9, full length proteins or domains or active fragments thereof are also provided.
[244] Probes, primers, antisense oligonucleotides and dsRNA
[245] Also provided are fragments thereof that can be used as probes or primers and can contain about 10 nucleotides, 14 nucleotides, generally 16 or more nucleotides, often about 30 or more nucleotides. The length of the probe or primer is a function of the genome size being probed; The larger the genome, the longer the probe or primer required for specific hybridization to a single location. One skilled in the art can select appropriately sized probes and primers. When modified in use, double-stranded probes and primers can be used.
[246] Probes and primers derived from nucleic acid molecules are provided. Such probes and primers are generally at least 8, 14, 16, 30, 100 contiguous nucleotides identical to the contiguous nucleotides of MTSP9, except for nucleotides 634-751 of SEQ ID NO: 5 or nucleotides 1162-1279 of SEQ ID NO: 17, and Excluding nucleotides 634-734 of SEQ ID NO: 5 (excluding nucleotides 1162-1262 of SEQ ID NO: 18), and contain at least 30, 50, or 100 contiguous sequences of nucleotides of SEQ ID NO: 5. Probes and primers can be optionally labeled with a detectable label, such as a radiolabel or a fluorescent tag, or mass discriminated for detection by mass spectroscopy or other means.
[247] Also provided are isolated nucleic acid molecules comprising a sequence of molecules complementary to a nucleotide sequence encoding MTSP9 or a portion thereof. Double stranded RNA (dsRNA), for example RNAi, is also provided.
[248] Plasmids, Vectors, and Cells
[249] Plasmids and vectors containing nucleic acid molecules are also provided. Cells containing such vectors, including cells expressing encoded proteins, are provided. The cells can be bacterial cells, yeast cells, fungal cells, plant cells, insect cells or animal cells. For example, provided herein are methods for producing a protease domain in MTSP or its single-chain form by growing a cell under conditions such that the encoded MTSP is expressed by the cell and recovering the protein so expressed. As will be appreciated, for MTSP9, full length simogens and activated proteins and activated (double-stranded) and single chain protease domains are provided. As discussed herein, the cells are used for protein expression, which can be secreted or expressed in the cytoplasm.
[250] As discussed below, the MTSP9 polypeptide, and its catalytically active portion, can be expressed on the cell surface. In addition, all or part thereof can be expressed as a secreted protein using natural signal sequences or heterologous signals. Alternatively, all or parts of the polypeptide may be expressed as inclusion bodies in the cytoplasm and separated therefrom. The obtained protein can be treated by refolding if necessary.
[251] The above discussion provides an overview and some detailed description of the illustrated MTSP9.
[252] C. Tumor Specificity and Tissue Expression Profiles
[253] Each MTSP has a characteristic tumor expression profile; MTSP is not only expressed or activated in tumors, but exhibits particularly characteristic tumor tissue expression or activation profiles. In some cases, MTSPs may differ from activity in non-tumor cells through changes in substrate or cofactors or other factors that may alter the apparent functional activity of that MTSP. Thus, each of these can be diagnosed for a particular tumor through the level of activity and / or expression or function in a subject with neoplastic disease (ie, a mammal, especially a human) as compared to the subject (s) without a neoplastic disease. It can serve as a medical marker. In addition, the detection of activity (and / or expression) in specific tissues is an indication of the presence of neoplastic disease. MTSP secreted in body fluids is an indicator of the presence of neoplastic disease. In addition, through each activity and / or expression profile, they may serve as therapeutic targets, for example, by administering their activity modulators or by administering prodrugs specifically activated by one of the MTSPs.
[254] Tissue expression profile
[255] MTSP9
[256] MTSP9 is expressed at high levels in the esophagus and at low levels in many other tissues. MTSP9 transcripts include kidney (adult and fetus), spleen (adult and fetus), placenta, liver (adult and fetus), thymus, peripheral blood leukocytes, lung (adult and fetus), pancreas, lymph nodes, bone marrow, airways, uterus, prostate , Testes, ovaries, and glandular organs (breast, adrenal gland, thyroid gland, pituitary gland, and saliva). MTSP9 is also expressed in esophageal tumor tissue, lung carcinoma, and low levels in colorectal carcinoma, lymphoma, cervix (HeLaS3) and leukemia cell lines.
[257] D. Identification and Isolation of MTSP9 Polypeptide Genes
[258] MTSP polypeptides and / or domains thereof can be obtained by methods well known in the art for protein purification and recombinant protein expression. Any method known to those skilled in the art can be used to identify nucleic acids encoding genes of interest. Using any method available in the art, a full length cDNA or genomic DNA clone encoding MTSP protein can be obtained (ie, covering the entire coding region). For example, using polymerase chain reaction (PCR), nucleic acids encoding sequences expressed in normal cells and tumor cells or tissues, such as MTSP9 polypeptides (SEQ ID NOS: 5 and 17) in genome or cDNA libraries, may be used. Can be amplified. Nucleic acid samples (RNA or DNA) from suitable sources (eg, tumor or cancer tissue), generally cDNA libraries, using oligonucleotide primers that hybridize with the 3 'and 5' terminal sequences of such identified sequences as primers Sequences can be amplified by PCR.
[259] For example, PCR can be performed by using a Perkin-Elmer Cetus thermal cycler and Taq polymerase (Gene Amp ™). Such amplified DNA may comprise mRNA or cDNA or genomic DNA from a eukaryotic species. For use in PCR reactions, one can choose to synthesize several different degenerate primers. In addition, in order to amplify nucleic acid homologues by allowing some nucleotide sequence similarity between the nucleic acid homologues to be isolated and known nucleotide sequences (e.g., obtaining MTSP polypeptide sequences from species other than humans or homologous to MTSP9 polypeptides). To obtain sequences), the stringency of the hybridization conditions used to initiate the PCR reaction can be varied. In the case of cross species hybridization, low or medium stringent conditions are used. In the case of the same species hybridization, medium or high stringent conditions are generally used. The condition can be determined empirically.
[260] After successfully amplifying a nucleic acid containing all or a portion of the identified MTSP polypeptide sequence, or a nucleic acid encoding all or a portion of the MTSP polypeptide homologue, the fragment can be molecularly cloned and sequenced and used as a probe. Complete cDNA or genomic clones can be isolated. This allows determining the complete nucleotide sequence of the gene of interest, analyzing its expression, and generating its protein product for functional analysis. Once the nucleotide sequence is determined, the MTSP polypeptide gene protein product is encoded using any method well known in the art to determine an open reading frame, such as a publicly available computer program for nucleotide sequence analysis. An open reading frame can be determined. Once an open reading frame is defined, it is common to determine the amino acid sequence of the protein encoded by this open reading frame. In this way, the nucleotide sequence of the entire MTSP polypeptide gene, as well as the amino acid sequence of the MTSP polypeptide and its analogs can be identified.
[261] All eukaryotic cells can potentially serve as a nucleic acid source for the molecular cloning of MTSP polypeptide genes. The nucleic acid may be isolated from vertebrates, mammals, humans, pigs, cattle, cats, birds, horses, dogs, as well as additional primate sources, insects, plants, and other organisms. DNA can be obtained by cloning, chemically synthesizing, or cDNA cloning of purified genomic DNA or fragments thereof from cells of interest, by procedures known in the art from cloned DNA (eg, DNA "libraries"). Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; Glover, D.M. (ed.), 1985, DNA Cloning: A Practical Approach, MRL Press, Ltd., Oxford, U.K. Vol. I, II]. Clones derived from genomic DNA may contain regulatory and intron DNA regions in addition to coding regions; Clones derived from cDNA contain only exon sequences. For any source, the gene is cloned into a vector suitable for its propagation.
[262] In the molecular cloning of genes from genomic DNA, DNA fragments are generated, some of which encode the genes of interest. DNA can be cleaved at specific sites using a variety of restriction enzymes. Alternatively, DNAse can be used to fragment the DNA in the presence of manganese, or the DNA can be physically cleaved, for example by sonication. The linear DNA fragments can then be sized by standard techniques, including but not limited to agarose and polyacrylamide gel electrophoresis and column chromatography.
[263] Once the DNA fragments are generated, specific DNA fragments containing the genes of interest can be identified in a number of ways. For example, a portion of an MTSP polypeptide (all species origin) gene (eg, an oligonucleotide having a partial sequence of a PCR amplification product or a known nucleotide obtained as mentioned above) or a specific RNA thereof, or a fragment thereof The resulting DNA fragments can be screened by nucleic acid hybridization with labeled probes. Benton and Davis, Science 196: 180 (1977); Grunstein and Hogness, Proc. Natl. Acad. Sci. USA 72: 3961 (1975). These DNA fragments will be substantially homologous to the probe being hybridized. It is also possible to identify suitable fragments by restriction enzyme digestion, where available, by comparing fragment size with the size expected by known restriction maps or DNA sequence analysis, and by known nucleotide sequences of the MTSP polypeptide. Further screening can be performed based on the nature of the gene in question. On the other hand, the presence of a gene can be detected by an assay based on the physical, chemical or immunological properties of its expressed product. For example, DNA clones that hybrid-select appropriate mRNA, or cDNA clones, can be selected that produce proteins with similar or identical electrophoretic mobility, isoelectric focusing behavior, proteolytic guidance, antigenicity, serine protease activity. have. If an anti-MTSP polypeptide antibody is available, the protein can be identified in the ELISA (enzyme linked immunosorbent assay) -type process by binding the labeled antibody to the putative MTSP polypeptide-synthetic clone.
[264] Another method of isolating MTSP9 polypeptide genomic DNA includes, but is not limited to, chemically synthesizing a gene sequence from known sequences, or making cDNA into mRNA encoding MTSP polypeptide. For example, RNA for cDNA cloning an SP protein gene can be isolated from cells expressing the protein. Such identified and isolated nucleic acids can then be inserted into a suitable cloning vector. Many vector-host systems known in the art can be used. Possible vectors include, but are not limited to, plasmids or modified viruses, and the vector system must be compatible with the host cell used. Such vectors include, but are not limited to, bacteriophage such as lambda derivatives, or plasmids such as pBR322 or pUC plasmid derivatives or Bluescript vectors (Stratagene, La Jolla, CA). Insertion into the cloning vector can be performed, for example, by linking the DNA fragment into a cloning vector with complementary cohesive ends. If the complementary restriction sites used to fragment the DNA are not present in the cloning vector, the ends of the DNA molecules can be enzymatically modified. Alternatively, any site of interest can be generated by linking a nucleotide sequence (linker) onto the DNA terminus; The linker so linked may comprise chemically synthesized specific oligonucleotides encoding restriction endonuclease recognition sequences. In another method, the cleaved vector and MTSP polypeptide gene can be modified by homopolymeric tailing. Since recombinant molecules can be introduced into host cells, for example, through transformation, transfection, infection, electroporation, and sonorporation, many copies of the gene sequence are produced.
[265] In certain embodiments, transforming a host cell with a recombinant DNA molecule incorporating an isolated MTSP polypeptide gene, cDNA or synthesized DNA sequence can produce multiple copies of that gene. Thus, such genes can be obtained in large quantities by growing transformants, separating recombinant DNA molecules from such transformants, and optionally recovering the inserted gene from the isolated recombinant DNA.
[266] E. Expression of Vectors, Plasmids and Cells, and MTSP Polypeptides Containing Nucleic Acids Encoding MTSP Polypeptides or Protease Domains thereof
[267] Vector and cell
[268] To recombinantly express one or more MTSP polypeptides, a nucleic acid containing all or part of the nucleotide sequence encoding such MTSP polypeptide is inserted into a suitable expression vector, i.e., a vector containing elements necessary for the transcription and translation of the inserted protein coding sequence. Can be. Essential transcriptional and translational signals may be supplied by the native promoter and / or their flanking regions for the MTSP gene.
[269] Also provided are vectors containing nucleic acids encoding MTSPs. Cells containing such vectors are also provided. Such cells include eukaryotic and prokaryotic cells, and the vector can be any suitable for use herein.
[270] Eukaryotic and prokaryotic cells (including endothelial cells) containing the vector are provided. Such cells include bacterial cells, yeast cells, fungal cells, plant cells, insect cells and animal cells. The cells mentioned above are grown under conditions that (a) express the protease domain of an encoded MTSP polypeptide or MTSP polypeptide by the cells, and (b) recover the protease domain protein so expressed, thereby using the cells. MTSP polypeptides or their protease domains are generated. In an exemplary embodiment, the protease domain is secreted into the medium.
[271] In one aspect, a vector is provided that has a protease activity of an SP protein and comprises a nucleotide sequence that encodes a polypeptide containing all or a portion of the protease domain of the SP protein, or multiple copies thereof. Also provided are vectors comprising nucleotide sequences encoding the protease domain and additional portions of the SP protein, up to and including the full length SP protein. The vector may be selected to express an SP protein or a protease domain thereof in a cell or may be selected to be expressed as a secreted protein. On the other hand, the vector may contain the signals necessary to secrete the encoded protein. When a protease domain is expressed, it is linked to a secretion signal, eg, a Saccharomyces cerevisia α crossing factor signal sequence or portion thereof, or a nucleic acid encoding the original signal sequence.
[272] Various host-vector systems can be used to express protein coding sequences. These include mammalian cell systems infected with viruses (eg vaccinia virus, adenovirus, etc.); Insect cell systems infected with viruses (eg baculovirus); Microorganisms containing yeast vectors such as yeast; Or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA. The expression elements of the vector vary in their strength and specificity. Depending on the host-vector system used, any of a number of suitable transcription and translation elements can be used.
[273] All vectors known to those skilled in the art by inserting nucleic acid fragments into a vector can be used to construct expression vectors containing chimeric genes containing appropriate transcriptional / translational regulatory signals and protein coding sequences. These methods may include in vitro recombinant DNA and synthetic techniques, and in vivo recombinant (genetic recombination) methods. Expression of the nucleic acid sequence encoding the MTSP polypeptide, or domain, derivative, fragment or homologue thereof, is regulated by a second nucleic acid sequence such that the gene or fragment thereof is expressed in a host transformed with the recombinant DNA molecule (s). do. For example, degradation of a protein can be controlled by all promoter-enhancers known in the art. In certain embodiments, the promoter is not gene native to the MTSP polypeptide. Promoters that can be used include the SV40 early promoter (Bernoist and Chambon, Nature 290: 304-310 (1981)); a promoter contained in the 3 'long terminal repeat of the Raus sarcoma virus [Yamamoto et al. Cell 22 : 787-797 (1980)] Herpes thymidine kinase promoter (Wagner et al., Proc. Natl. Acad. Sci. USA 78: 1441-1445 (1981)); regulatory sequence of the metallothionein gene Brinster et al., Nature 296: 39-42 (1982); prokaryotic expression vectors such as the β-lactamase promoter [Villa-Kamaroff et al., Proc. Natl. Acad. Sci USA 75: 3727-3731 1978; or tac promoter [DeBoer et al., Proc. Natl. Acad. Sci. USA 80: 21-25 (1983); “Useful Proteins from Recombinant Bacteria”: in Scientific American 242: 79-94 (1980)]; plant expression vectors containing the nopaline synthetase promoter (Herrar-Estrella et al., Nature 303: 209-213 (1984)) or the cauliflower mosaic virus 35S RNA promo Garder et al., Nucleic Acids Res. 9: 2871 (1981), and promoters of the photosynthetic enzyme ribulose bisphosphate carboxylase (Herrera-Estrella et al., Nature 310: 115-120 (1984). ))]; Promoter elements from yeast and other fungi, such as the Gal4 promoter, the alcohol dehydrogenase promoter, the phosphoglycerol kinase promoter, the alkaline phosphatase promoter, and the following animal transcriptions that have been used in transformed animals Regulatory region: Elastase I gene regulatory region active in pancreatic staphyloid cells (Swift et al., Cell 38: 639-646 (1984)); Ornitz et al., Cold Spring Harbor Symp. Quant. Biol. 50: 399-409 (1986); MacDonald, Hepatology 7: 425-515 (1987); Insulin gene regulatory regions active in pancreatic beta cells (Hanahan et al., Nature 315: 115-122 (1985)), immunoglobulin gene regulatory regions active in lymphoid cells [Grosschedl et al., Cell 38: 647-658 (1984); Adams et al., Nature 318: 533-538 (1985); Alexander et al., Mol. Cell Biol. 7: 1436-1444 (1987)], mouse mammary tumor tumor virus regulatory regions active in testes, breast, lymphoid and mast cells [Leder et al., Cell 45: 485-495 (1986)], active in the liver Phosphorus albumin gene regulatory region [Pinckert et al., Genes and Devel. 1: 268-276 (1987))), an alpha-fetoprotein gene regulatory region active in the liver (Krumlauf et al., Mol. Cell. Biol. 5: 1639-1648 (1985); Hammer et al., Science 235: 53-58 (1987)], alpha-1 antitrypsin gene regulatory region active in the liver (Kelsey et al., Genes and Devel. 1: 161-171 (1987)], beta globin gene regulatory region active in myeloid cells (Mogram et al., Nature 315: 338-340 (1985); Kollias et al., Cell 46: 89-94 (1986)], myelin basic protein gene regulatory regions active in oligodendrocytes in the brain (Readhead et al., Cell 48: 703-712 (1987)), skeletal muscle Myosin light chain-2 gene regulatory region active in Sani, Nature 314: 283-286 (1985), and gonadotropin gene regulatory region active in hypothalamic gonadotropin secretion cells (mason et al. al., Science 234: 1372-1378 (1986)].
[274] In certain embodiments, it contains a promoter, one or more origins of replication, and any one or more selectable markers (eg, antibiotic resistance genes) operably linked to a MTSP polypeptide, or a nucleic acid encoding a domain, fragment, derivative, or homologue thereof. Vectors are used. Expression vectors containing the coding sequence of the MTSP polypeptide or a portion thereof are prepared by acloning the coding portion into the EcoRI restriction site of each of the three pGEX vectors [glutathione S-transferase expression vector (Smith and Johnson, Gene 7:31). -40 (1988)). This allows the product to be expressed in the correct reading frame. Examples of vectors and systems for expressing the protease domain of MTSP polypeptides include the well-known Pichia vector (Source: Invitrogen, San Diego, CA), especially those designed to secrete encoded proteins. The protein can also be expressed in the cytoplasm, for example inclusion bodies. One exemplary vector is described in this example.
[275] this. Plasmids for transforming E. coli cells include, for example, pET expression vectors (US Pat. No. 4,952,496; Source: NOVAGEN, Madison, WI; See literature published by Novagen describing this system. These plasmids include T7lac promoter, T7 terminator, inducible E. coli. PET 11a containing the E. coli lac effector and lac inhibitor genes; T7 promoter, T7 terminator, and two. PET 12a-c containing E. coli ompT secretion signal; And pET 15b and pET 19b containing a His-Tag ™ leader sequence, a T7-lac promoter region and a T7 terminator for use in purification using His columns and thrombin cleavage sites, which are cleaved and purified on the column. , Madison, WI).
[276] Vectors may be expressed in host cells, such as pichia cells and bacterial cells, such as E. coli. When introduced into E. coli cells, proteins are expressed in the eye. An example of a Peach strain is GS115. Examples of bacterial hosts may contain chromosomal copies of DNA encoding inducible promoters such as T7 RNA polymerase operably linked to lacUV promoters (see US Pat. No. 4,952,496). These hosts include soluble E. coli. E. coli strain BL21 (DE3) is included, but is not limited thereto.
[277] Expression and Production of Proteins
[278] MTSP domains, analogs and homologues can be generated by a variety of methods known in the art. For example, once a recombinant cell expressing an MTSP polypeptide, or domain, fragment or derivative thereof, is identified, individual gene products can be isolated and analyzed. This is accomplished by assays based on the physical and / or functional properties of the protein, which involves radiolabeling the product and then analyzing it by gel electrophoresis, immunoassay, cross-linking to the marker-labeled product Methods, and assays of proteolytic activity include, but are not limited to.
[279] MTSP polypeptides can be isolated and purified by standard methods known in the art (from recombinant host cells or natural sources expressing the complex or protein of interest), which include column chromatography (eg, ion exchange, affinity, gel). Exclusion, reversed phase high pressure, rapid protein liquid, etc.), differential centrifugation, differential solubility, or other standard techniques used for protein purification. Functional properties can be assessed using any suitable assay known in the art.
[280] Alternatively, once the MTSP polypeptide or domain or derivative thereof is identified, the amino acid sequence of the protein can be deduced from the nucleotide sequence of the gene encoding it. As a result, the protein or domain or derivative thereof can be synthesized by standard chemical methods known in the art (see Hunkapiller et al., Nature 310: 105-111 (1984)).
[281] Manipulation of the MTSP polypeptide sequence can be done at the protein level. In addition, during or after detoxification, for example, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, linkage to antibody molecules or other cellular ligands, and the like. MTSP polypeptide proteins, domains, derivatives, homologs or fragments thereof, which are differentially modified by the invention are contemplated herein. Numerous chemical modifications are known techniques, for example cyano bromide, trypsin, chymotrypsin, papain, V8 protease, specific chemical cleavage by NaBH ₄ , acetylation, formylation, oxidation, reduction, tunicamycin And metabolic synthesis in the presence of other such agents.
[282] In addition, domains, homologues and derivatives of MTSP polypeptides can be chemically synthesized. For example, peptides corresponding to specific portions of the MTSP polypeptide, including the domain of interest or mediating the desired in vitro activity, can be synthesized by using a peptide synthesizer. Moreover, if desired, non-traditional amino acids or chemical amino acid analogs may be introduced into the MTSP polypeptide sequence as substituents or adducts. Non-traditional amino acids usually include D-isomers of amino acids, a-amino butyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, ε-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid , 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluorine Low-amino acids, designer amino acids such as, but not limited to, β-methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid homologues in general. Furthermore, the amino acid may be D (preferred) or L (left).
[283] If the natural product is presumed to be mutant or isolated from a new species, the amino acid sequence of the MTSP polypeptide from the expression vector not only isolated from the natural source but also expressed in vitro or synthesized in vivo or in vitro is expressed in DNA. It can be determined from sequencing or by direct sequencing of isolated proteins. Such analysis can be performed by sequencing manually or using an automated amino acid sequencer.
[284] transform
[285] Various modifications of the MTSP polypeptide and domain are contemplated herein. MTSP-encoding nucleic acid molecules can be modified by a number of strategies known in the art. See Sambrook et al. (1990) Molecular Cloning, A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. This sequence is cleaved at the appropriate site with restriction endonuclease (s) and then further enzymatically modified, if desired, isolated and then linked in vitro. In generating genes encoding domains, derivatives or homologues of MTSPs, care must be taken to ensure that the modified gene retains the original reading frame, which is not hindered by the detoxification signal in the gene region where the desired activity is encoded.
[286] In addition, the MTSP-encoding nucleic acid molecule is mutated in vitro or in vivo to generate and / or destroy translation, initiation and / or termination sequences, or to generate variants in the coding region and / or new restriction. Endonuclease sites can be formed or existing ones can be promoted to promote further in vitro modification. Also contemplated are muteins that have changed their primary sequence, eg, replaced Cys residues and removed glycosylation sites, as described herein; MTSP9 of SEQ ID NO: 18 has two potential glycosylation sites. Such mutations can be carried out by any mutagenesis technique known in the art, including chemical mutagenesis and in vitro site-directed mutagenesis. See Hutchinson et al., J. Biol. Chem. 253: 6551-6558 (1978), include, but are not limited to, the use of the TAB ^® linker (Pharmacia). In one embodiment, for example, the MTSP polypeptide or domain thereof is modified to include a fluorescent label. In other specific embodiments, the MTSP polypeptide is modified to have a hetero-functional reagent so that the hetero-functional reagent can be used to crosslink members of the complex.
[287] In addition, domains, homologues and derivatives of MTSP polypeptides can be chemically synthesized. For example, peptides corresponding to specific portions of MTSPs that contain the domain of interest or mediate desired in vitro activity can be synthesized by using a peptide synthesizer. Furthermore, if desired, non-traditional amino acids or chemical amino acid analogs may be introduced into the MTSP sequence as substituents or adducts. Non-traditional amino acids usually include D-isomers of amino acids, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, ε-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino iso Butyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, Fluoro-amino acids, designer amino acids such as, but not limited to, β-methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid homologues in general. Furthermore, the amino acid may be D (preferred) or L (left).
[288] F. Screening Method
[289] Single chain protease domains as set forth herein can be used in a variety of methods for identifying compounds that modulate their activity. In the case of SPs which exhibit higher activity or expression in tumor cells, compounds which inhibit proteolytic activity are of particular interest. For SPs that exhibit lower levels of activity in tumor cells, compounds or agents that enhance this activity are potentially of interest. In all cases, the compounds identified as above include agents that are candidate cancer therapeutics.
[290] Several types of assays are illustrated and described herein. It should be appreciated that the protease domain can be used for other assays. However, single chain protease domains are shown herein to exhibit catalytic activity. As such, it is ideal for in vitro screening assays. These can also be used for binding assays.
[291] MTSP9 Full-length simogen, activated enzyme, single-stranded and double-stranded protease domains are contemplated for use in all screening assays known to those of skill in the art, including those provided herein. Thus, where the following description is directed to proteolytic assays, this may apply to the use of single chain protease domains of all MTSPs (including MTSP9) or catalytically active portions thereof. In particular provided herein are other assays, such as binding assays, for use with MTSP9 and all variants thereof (eg, splice variants).
[292] 1. Catalytic Assay to Identify Agents That Modulate Protease Activity of SP Proteins
[293] Provided herein are methods of identifying catalytic activity modulators of an SP, particularly its single-chain protease domain or catalytically active moiety. This method evaluates the activity of MTSP9 by contacting MTSP9, a full-length simogen or activated form, and, in particular, its single-chain domain with the substrate of MTSP9 in the presence of a test substance and assaying the proteolytic action of this substrate and This can be done by comparing it with the activity of the control. For example, the control group may be prepared by contacting MTSP9, in particular its single chain domain, with its full-length simogen or activated form, and in particular its single chain domain, with the substrate of MTSP9 and detecting the proteolytic action of such substrate. It may be the activity of MTSP9 evaluated by assessing the activity. The results in the presence and absence of the test compound are compared. The difference between the activities indicates that the test substance modulates the activity of MTSP9. Activators of MTSP9 activated cleavage are also contemplated, which assays are discussed next.
[294] In one embodiment, multiple test substances are screened simultaneously in the screening method. In another embodiment, MTSP9 is isolated from the target cell as a means for identifying an agent potentially specific for the target cell.
[295] In another embodiment, because the test agent is a therapeutic compound, the difference between the MTSP9 activity measured in the presence and absence of the test substance indicates that the target cell responds to the therapeutic compound.
[296] One method includes (a) contacting an MTSP9 polypeptide or protease domain thereof with one or more test compounds under conditions such that interactions between the ligand and the compound are performed; And b) identifying one or more compounds of the plurality that specifically bind the ligand.
[297] Another method provided herein comprises the steps of: a) assessing the activity of MTSP9 polypeptide by contacting the MTSP9 polypeptide or protease domain thereof with a substrate of the MTSP9 polypeptide and detecting the proteolytic action of such substrate; b) assessing the activity of the MTSP9 polypeptide by contacting the MTSP9 polypeptide or its protease domain with a substrate of the MTSP9 polypeptide in the presence of a test substance and detecting the proteolytic activity of the substrate; And c) comparing the activity of the MTSP9 polypeptide evaluated in steps a) and b), wherein the activity measured in step a) is different from the activity measured in step b). Indicates that it regulates activity.
[298] In another embodiment, multiple test substances are screened at the same time. In comparing the activity of MTSP9 polypeptides in the presence and absence of a test substance to assess whether a particular test substance is a modulator of the MTSP9 polypeptide, these activities need not be assayed simultaneously (side by side), although such simultaneous measurements are typical. The activity of the MTSP9 polypeptide may be measured once and the activity thus determined may be compared with the historical activity value of the MTSP9 polypeptide.
[299] For example, the activity of the MTSP9 polypeptide can be measured in the presence of a test substance and compared to the historical activity value of the MTSP9 polypeptide previously measured in the absence of the test substance. This can be done, for example, by providing the activity of the MTSP9 polypeptide on an insert or pamphlet provided with a kit for performing the assay.
[300] Methods for selecting substrates for particular SPs are described in this example, and specific proteolytic assays are illustrated.
[301] A kit containing the combination is provided, optionally including a combination and instructions for performing the assay. Such combinations include MTSP9 polypeptides and substrates of MTSP9 polypeptides to be assayed; And optionally reagents for detecting the proteolytic action of such substrates. Substrates that have been proteolytically reacted by a particular MTSP9 polypeptide, which may be chromogenic or fluorogenic molecules, which include proteins, can be identified experimentally by testing the ability of the MTSP9 polypeptide to cleave a test substance. The substrate that is cleaved most efficiently (ie, cleaved at the lowest concentration and / or at the fastest rate or under the desired conditions) is identified.
[302] In addition, provided herein are kits containing the aforementioned combinations. Such kits optionally include instructions for identifying MTSP9 polypeptide activity modulators. All MTSP9 polypeptides are considered as targets for identifying their activity modulators.
[303] 2. Linkage black
[304] Also provided herein are methods of identifying and isolating agents, in particular compounds that bind MTSP9. Such assays may be performed in the form of a simogen, an isolated protease domain of a single chain (or a protein other than an MTSP9 polypeptide containing the protease domain of an MTSP9 polypeptide), and an activated form (such as a protease derived from or elongated from a full-length simogen). And activating forms derived from the domain are included). Compounds so identified are candidates or leaders for identifying compounds for treating tumors and other disorders and diseases associated with aberrant angiogenic processes. The MTSP9 polypeptides used in the method include all MTSP9 polypeptides as defined herein, including the MTSP9 single chain protease domain or proteolytically active portion thereof.
[305] Various methods are provided herein. These methods can be carried out in solution or solid phase reactions that connect the MTSP9 polypeptide (s) or protease domain (s) thereof directly or indirectly through a linker to the solid support. Screening assays are described in this example, and these assays have been used to identify candidate compounds. For purposes of this application, all of the above mentioned binding assays are provided for MTSP9.
[306] Provided herein are methods for identifying an agent, eg, a compound, that specifically binds an MTSP9 single-chain protease domain, a simogen, or a full-length activated MTSP9 or a double-stranded protease domain thereof. Such a method comprises the steps of: a) contacting MTSP9 with one or more test agents under conditions such that binding between the MTSP9 and the agent is performed; And b) identifying one or more of the plurality of agents that specifically bind MTSP9.
[307] For example, in practicing this method, the MTSP9 polypeptide is mixed with an extract or fraction of a particular cell, or with a potential binding partner, under conditions that allow association of the polypeptide with a potential binding partner. After mixing, peptides, polypeptides, proteins or other molecules associated with MTSP9 are separated from the mixture. The binding partner bound to MTSP9 can then be removed and further analyzed. To identify and isolate binding partners, the entire protein can be used, for example the entire protein set forth in SEQ ID NO: 6. Alternatively, fragments of these proteins can also be used.
[308] Various methods can be used to obtain cell extracts or body fluids such as blood, serum, urine, sweat, synovial fluid, CSF and other body fluids. For example, physical or chemical destruction methods can be used to destroy cells. Examples of physical destruction methods include, but are not limited to, sonication and mechanical shearing methods. Examples of chemical dissolution methods include, but are not limited to, detergent dissolution and enzyme dissolution. The skilled artisan can readily adapt the method of making the cellular extract to obtain an extract for use in the present method.
[309] Once cell extracts are prepared, these extracts are mixed with MTSP9 under conditions where association between the protein and the binding partner can occur. Various conditions can be used, including those similar to those found in body fluids such as the cytoplasm or blood of human cells. The characteristics of the cellular extracts used, such as osmotic pressure, pH, temperature and concentration, can be varied in various ways to optimize the association between the protein and the binding partner. Similarly, methods of separating molecules of interest from body fluids are known.
[310] After mixing under appropriate conditions, the bound complex is separated from the mixture. Various techniques can be used to separate the mixture. For example, antibodies specific for MTSP9 can be used to immunoprecipitate binding partner complexes. Alternatively, standard chemical separation techniques such as chromatography and density / sedimentation centrifugation can be used.
[311] After removal of the unassociated cellular components in the extract, the binding partner can be dissociated from the complex using conventional methods. For example, dissociation can be performed by changing the salt concentration or pH of the mixture.
[312] To assist in separating the associated binding partner pairs from the mixed extract, MTSP9 can be immobilized on a solid support. For example, the protein can be attached to nitrocellulose matrix or acrylic beads. Attaching the protein or fragment thereof to the solid support aids in separating the peptide / binding partner pairs from other components found in the extract. The binding partner identified as such may be a single protein or a complex consisting of two or more proteins.
[313] Alternatively, nucleic acid molecules encoding single-chain proteases can be used in yeast two-hybrid systems. Such yeast two-hybrid systems have been used to identify other protein partner pairs, which can be readily adapted to use the nucleic acid molecules described herein.
[314] In particular another in vitro binding assay for MTSP9 utilizes a mixture of a polypeptide containing at least the catalytic domain of one of these proteins with one or more candidate binding targets or substrates. After incubating this mixture under appropriate conditions, the ability of MTSP9 or a polypeptide fragment thereof containing the catalytic domain to bind or interact with the candidate substrate is assessed. For cell-free binding assays, one of these components comprises or is coupled to a detectable label. The label may be provided for direct detection such as radioactivity, luminescence, light density or electron density, or indirect detection such as epitope tags, enzymes and the like. Various methods can be used to detect the label depending on the type of label and other assay components. For example, a label bound to a solid substrate can be detected or a specific portion of the bound complex containing the label can be separated from the solid substrate and then the label can be detected.
[315] 3. Detection of Signaling
[316] MTSP9, a transmembrane protein, may be involved in signal transduction either directly or indirectly as a cell surface receptor, or indirectly by activating a protein capable of initiating signal transduction, eg, a growth promoter.
[317] In addition, the secreted MTSP9, eg, the extracellular domain of MTSP9, is a protein that can be directly involved in the signal transduction by binding to or interacting with a cell surface receptor or initiating signal transduction, for example, It may be indirectly involved by activating growth promoters. Assays for assessing signal transduction are well known to those skilled in the art and can be modified for use with MTSP9 polypeptides.
[318] MTSP9, in particular full length, or directly or indirectly, for example, through the activation of growth promoters, by means of a portion sufficient to anchor the extracellular domain or functional portion thereof to the surface of a particular cell. Assays are provided for identifying agents that affect or alter signal transduction. Such assays include, for example, transcription-use assays that assess the regulatory action of the converted signal by detecting the effect on expression from the reporter gene (see US Pat. No. 5,436,128).
[319] 4. Methods for Identifying Agents That Control Expression of Nucleic Acids Encoding MTSP9
[320] Another aspect provides a method of identifying an agent that modulates the expression of a nucleic acid encoding MTSP9. This assay uses all means available to monitor changes in expression levels of nucleic acids encoding MTSP9.
[321] In one assay format, cell lines containing reporter gene fusions between the open reading frame of MTSP9 or its domain, in particular the protease domain, and all assayable fusion partners can be prepared. Assays Many possible fusion partners are known and readily available and include genes encoding firefly luciferase gene and chloramphenicol acetyltransferase. See also Alam et al., Anal. Biochem. 188: 245-54 (1990). The cell line containing the reporter gene fusion is then exposed to the agent to be tested under suitable conditions and time. Due to the different expression of the reporter gene between the sample exposed to the agent and the control sample, agents that regulate the expression of nucleic acids encoding MTSP9 can be identified.
[322] Additional assay forms can be used to monitor the ability of an agent to modulate the expression of nucleic acids encoding MTSP9. For example, mRNA expression can be directly monitored by hybridizing with nucleic acid. The cell line is exposed to the agent to be tested for appropriate conditions and times, and total RNA or mRNA is isolated by standard procedures. See Sambrook et al. (1989) MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed. Cold Spring Harbor Laboratory Press. Probes for detecting RNA expression level differences between cells exposed to the preparation and control cells can be prepared from the nucleic acid. While it is typical to design probes that hybridize only to target nucleic acids under high stringent conditions, this is not a requirement. Under high stringent conditions, only highly complementary nucleic acid hybrids are formed. Thus, the stringency of the assay conditions determines the amount of complementarity that must exist between two nucleic acid chains to form a hybrid. Stringency should be chosen to maximize the difference in stability between probe: target hybrid and potential probe: non-target hybrid.
[323] Probes can be designed from nucleic acids via methods known in the art. For example, the G + C content and probe length of a probe can affect the probe's binding to its target sequence. Methods for optimizing probe specificity are commonly available. See Sambrook et al. (1989) MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed. Cold Spring Harbor Laboratory Press); and Ausubel et al. (1995) CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Greene Publishing Co., NY.
[324] Hybridization conditions are modified as required for each probe using known methods. See Sambrook et al. (1989) MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed. Cold Spring Harbor Laboratory Press); and Ausubel et al. (1995) CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Greene Publishing Co., NY. Hybridization of concentrated RNA to total cellular RNA or polyA RNA may be performed in any form available. For example, RNA enriched for total cellular RNA or polyA RNA is immobilized on a solid support, and the solid support is subjected to one or more of the nucleic acid molecules or a portion of one of them under conditions such that the probe specifically hybridizes. It is exposed to at least one probe comprising a. Alternatively, nucleic acid fragments comprising one or more of these sequences or portions of one of them may be immobilized on a solid support, such as a porous glass wafer. The glass wafer can then be exposed to total cellular RNA or poly A RNA from a particular sample under conditions that the immobilized sequence specifically hybridizes. Such glass wafers and hybridization methods can be widely used, for example, as described in WO 95/11755 (Beattie). Upregulation or downregulation of the expression of nucleic acids encoding MTSP9 polypeptides by examining the ability of certain probes to hybridize specifically with RNA samples from a population of cells exposed to a particular agent and with RNA samples from an untreated cell population. Identifies the formulation to be.
[325] In one form, the relative amount of protein between the cell population exposed to the agent to be tested can be assayed relative to the unexposed control cell population (eg, prostate cancer cell line, lung cancer cell line, colon cancer cell line, or breast cancer). Cell lines). In this form, probes, eg, specific antibodies, are used to monitor the activity level or different expression of the protein of interest in different cell populations or body fluids. The cell line or population or body fluid is exposed to the agent to be tested under suitable conditions and time. Cellular lysates or body fluids can be prepared from the cell lines or populations expressed above and the unexposed cell lines or populations of the control or unexposed body fluids. This cellular lysate or body fluid is then analyzed using a probe.
[326] For example, the N- and C-terminal fragments of MTSP9 can be expressed in bacteria and used to examine the proteins that bind to these fragments. Fusion proteins such as His-tags or GST fusions to the N- or C-terminal regions of MTSP9 can be prepared for use as substrates. These fusion proteins can be coupled, for example, to glutathione-sepharose beads, and then probed into cell lysates or body fluids. Prior to lysis, the cells or body fluids can be treated with candidate agents capable of modulating proteins that interact with MTSP9 or the domains present thereon. Lysate protein binding to the fusion protein can be cleaved by SDS-PAGE, as known in the art, can be isolated and identified by protein sequencing or mass spectrometry.
[327] Antibody probes are those that are of sufficient length, eg, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40 or more of the MTSP9 polypeptide. If it is a contiguous amino acid or is required for immunogenicity enhancement, it is prepared by immunizing a suitable mammalian host with a suitable immunization protocol using peptides, polypeptides or proteins conjugated to a suitable carrier. Methods of preparing immunogenic conjugates with carriers such as bovine serum albumin (BSA), keyhole limpet hemocyanin (KLH) or other carrier proteins are well known in the art. In some situations, direct conjugation using, for example, carbodiimide reagents may be effective; In other cases, linking reagents as provided by the supplier (Pierce Chemical Co., Rockford, IL) may be desirable to provide access to the hapten. The hapten peptide can be stretched at either the amino or carboxy terminus with a Cys residue or can be interspersed with a cysteine residue to facilitate, for example, linkage to the carrier. Administration of the immunogen is generally performed by using a suitable adjuvant for a suitable period of time, as generally recognized in the art. During the immunization schedule, the antibody titer is taken into account to determine the validity of antibody formation.
[328] For example, synthetic peptides corresponding to the carboxy terminal amino acids of MTSP9 can be used to generate anti-peptide antibodies. Synthetic peptides can be as small as 1 to 3 amino acids in length and are generally at least 4 amino acid residues in length. This peptide can be coupled to KLH using standard methods and immunized into animals (eg rabbits or ungulates). The polyclonal antibodies can then be purified, for example, using actigel beads containing covalently bound peptides.
[329] Although polyclonal antiserum produced in this manner is satisfactory for some applications, for pharmaceutical compositions, monoclonal preparations are generally used. Monoclonal of interest using standard methods of Kohler et al., Nature 256: 495-7 (1995), or modifications that affect the immortalization of lymphocytes or spleen cells, as is generally known. Immortalized cell lines can be prepared that secrete local antibodies. Such immortalized cell lines secreting the antibody of interest are screened by immunoassay wherein the antigen is a peptide hapten, polypeptide or protein. When identifying an appropriate immortalized cell culture that secretes the antibody of interest, the cells may be cultured by in vivo production via ascites fluid or in vitro. Of particular interest are monoclonal antibodies that recognize the catalytic domain or activating cleavage site (region) of MTSP9.
[330] Additionally, the simogen or double-stranded form of MTSP9 can be used to make monoclonal antibodies that recognize conformational epitopes. The desired monoclonal antibody can then be recovered from the culture supernatant or plural supernatants. Fragments of monoclonal or polyclonal antiserum containing immunologically important moieties can be used as antagonists as well as native antibodies. Immunologically reactive fragments such as Fab, Fab ', F (ab') ₂ fragments are often used, especially in therapeutic contexts, since these fragments are generally less immunogenic than complete immunoglobulins.
[331] Antibodies or fragments may also be generated. Regions that specifically bind to the desired region of the receptor may also be created in the context of chimeras with multiple species origins.
[332] Agents assayed in this method can be randomly selected or rationally selected or designed.
[333] Such agents can be, for example, peptides, small molecules and carbohydrates. Those skilled in the art can readily appreciate that there are no restrictions regarding the structural properties of these formulations.
[334] Peptide formulations can be prepared using standard solid phase (or solution phase) peptide synthesis methods, as known in the art. In addition, DNAs encoding these peptides can be synthesized using commercially available oligonucleotide synthesis instruments and recombinantly generated using standard recombinant production systems. Production using solid phase peptide synthesis is essential when it is necessary to include non-gene-encoded amino acids.
[335] G. Screening and Assay Formats for Test Substances That Modulate One or More Activities of the MTSP9 Polypeptide
[336] Methods of identifying agents that modulate one or more activities of MTSP9 are provided. Such methods include phage display and other methods of assessing changes in activity of MTSP9. Such methods or assays can employ any means of monitoring or detecting the desired activity. Various forms and detection protocols are known for performing screening assays. The format and protocol can be modified to identify MTSP9 polypeptide activity modulators. A discussion of examples of protocols follows.
[337] 1. High Throughput Screening Assay
[338] Although the above-mentioned assays, which screen for a single MTSP9 polypeptide and / or screen a single test substance in one assay, can be performed, the phase assay typically performs in a high throughput screening manner, i.e., screening multiple SP proteins. And / or screen multiple test substances simultaneously. High Throughput Screening: The Discovery of Bioactive Substances (Devline, Ed.) Marcel Dekker, 1997; Sittampalam et al., Curr. Opin. Chem. Biol., 1: 384-91 (1997); and Silverman et et al., Curr. Opin. Chem. Biol., 2: 397-403 (1998). For example, the assay can be performed in a multi-well (eg, 24-, 48-, 96-, 384-, 1536-well or higher density), chip or array format.
[339] High-throughput screening (HTS) is the process of testing a number of different chemical structures against disease targets to identify "hits". Sittampalam et al., Curr. Opin. Chem. Biol., 1: 384-91 (1997). The current state of the art HTS operation is highly automated and handles the sample formulation and is used for the assay and subsequent large data processing.
[340] The detection technique used for high-throughput screens depends on the type of biochemical pathway being studied (Sittampalam et al., Curr. Opin. Chem. Biol., 1: 384-91 (1997). These methods include radiochemical methods, for example, scintillation proximity assays (SPA) that can be adapted to various enzyme assays (Lerner et al., J. Biomol. Screening, 1: 135-143 (1996); Baker et al., Anal. Biochem., 239: 20-24 (1996); Baum et al., Anal. Biochem., 237: 129-134 (1996); and Sullivan et al., J. Biomol. Screening 2: 19-23 (1997)] and protein-protein interaction assays (Braunwalder et al., J. Biomol. Screening 1: 23-26 (1996); Sonatore et al. Anal. Biochem. 240: 289-297 (1996); and Chen et al., J. Biol. Chem. 271: 25308-25315 (1996); And colorimetric and luminescence detection methods, resonance energy transfer (RET) methods, time-resolved fluorescent (HTRF) methods, cell-use fluorescent assays, such as fluorescent resonance energy transfer (FRET) procedures, see Gonzalez et al., Biophys. J., 69: 1272-1280 (1995)], fluorescent polarization or anisotropic methods (James et al., Methods Enzymol. 246: 283-300 (1995); Jolley, J. Biomol. Screening 1: 33-38 (1996); Lynch et al., Anal. Biochem. 247: 77-82 (1997), non-isotopic detection methods including, but not limited to, fluorescent correlation spectroscopy (FCS), and other methods.
[341] 2. Test substance
[342] Test compounds, including small molecules, antibodies, proteins, nucleic acids, peptides, and libraries and aggregates thereof, can be screened in the above-mentioned assays to identify compounds that modulate the activity of MTSP9 polypeptides and the assays described below. . Using rational drug design methodologies that rely on computer-assisted chemistry, candidate compounds can be screened and identified.
[343] Compounds identified by this screening method include inhibitors (including antagonists), which may be agonists. Compounds for screening include all compounds and collections of compounds that are available, known or prepared.
[344] a. Screening of Compounds
[345] Compounds can be targeted for inhibition of selectivity and efficacy of serine proteases, in particular MTSP9 polypeptides. As described herein, and generally known, the target serine protease and its substrate are combined under assay conditions that allow a reaction between such protease and its substrate. This assay is performed in the absence of test compound and in the presence of increasing concentration of test compound. The concentration of the test compound at which 50% of the serine protease activity is inhibited by the test compound is the IC ₅₀ value (inhibitory concentration) or EC ₅₀ value (effective concentration) for that compound. Within a test compound series or group, compounds having lower IC ₅₀ values or EC ₅₀ values are considered to be more potent inhibitors of serine proteases than compounds having higher IC ₅₀ values or EC ₅₀ values. IC ₅₀ value measurements are often used for simpler assays, while EC ₅₀ value measurements are often used for more complex assays, eg, assays using cells.
[346] Typically, candidate compounds have an IC ₅₀ value of 100 nM or less as measured in an in vitro assay for inhibition of MTSP9 polypeptide activity. Test compounds are tested for their selectivity to serine proteases. As described herein, and generally known, test compounds are assayed for their efficacy against a panel of serine proteases and other enzymes, and IC ₅₀ values or EC for each test compound in each assay system. Determine ₅₀ values. Compounds that exhibit low IC ₅₀ values or EC ₅₀ values for target enzymes, eg, MTSP9 polypeptides, and higher for other enzymes in the test panel (eg, urokinase tissue plasminogen activator, thrombin, factor Xa) IC ₅₀ values or EC ₅₀ values are considered selective for the target enzyme. In general, when an IC ₅₀ value or EC ₅₀ value in a target enzyme assay is at least one of the order of less than the smallest IC ₅₀ value or EC ₅₀ value measured in the selectivity panel of the enzyme, the particular compound is considered to be selective. do.
[347] The compounds are also subjected to evaluation of their in vivo activity. The type of assay selected for evaluating the test compound depends on the route of administration to be evaluated for the test compound as well as the pathological disease to be treated or prevented by the use of such compound.
[348] For example, to assess the activity of compounds that lower tumor growth through inhibition of MTSP9 polypeptides, PAI-1 can be evaluated by Jankun et al., Canc. Res. 57: 559-563 (1997). Briefly, ATCC cell lines DU145 and LnCaP are injected into SCID mice. After the tumor has settled, the mice are given a test compound according to the dosage regimen determined from the in vitro specificity of the compound. The compound of this document is administered in water. Tumor volume is measured twice weekly for about 5 weeks. If the animal to which the test compound was administered exhibits reduced tumor volume compared to the animal to which the appropriate control compound was administered, the compound is considered to be active.
[349] Another in vivo experimental model designed to assess the effect of p-aminobenzamidine (which is a pig protease inhibitor) on reducing tumor volume is described in Billstrom et al., Int. J. Cancer 61: 542-547 (1995).
[350] To assess the ability of compounds to reduce metastasis or inhibit metastasis, see Kobayashi et al., Int. J. Canc. 57: 727-733d (1994). Briefly, mouse xenograft grafts were selected for high pulmonary metastasis potential in intravenously injected C57B1 / 6 mice (experimental metastasis) or subcutaneously injected abdominal wall (voluntary metastasis). Compounds of various concentrations to be tested can be mixed with tumor cells in Matrigel prior to injection. 1-6 days or 7-13 days after tumor inoculation, test compounds are injected intraperitoneally daily. About three or four weeks after tumor inoculation the animals are sacrificed and lung tumor colonies are counted. By evaluating the generated data, the efficacy, optimal dosage and route of administration of the test compound can be determined.
[351] The activity of test compounds in reducing tumor volume and metastasis is described by Rabbani et al., Int. J. Cancer 63: 840-845 (1995) can be used to evaluate their inhibitors. Here, Mat LyLu tumor cells are injected into the flanks of Copenhagen rats. The animal is implanted with an osmotic minipump and continuously administered various amounts of test compound up to 3 weeks. Tumor mass and volume of the experimental and control animals are evaluated during the experiment and metastatic growth is also assessed. By evaluating the generated data, the efficacy, optimal dosage and route of administration of the test compound can be determined. Some of these authors describe related protocols in Xing et al., Canc. Res. 57: 3585-3593 (1997).
[352] To assess the anti-angiogenic activity of the compounds, rabbit corneal angiogenesis models can be used. See Avery et al., (1990) Arch. Ophthalmol., 108: 1474-147]. This document describes the procedure of anesthetizing a New Zealand white rabbit, followed by dissection of the central cornea and formation of radial corneal pockets. Sustained release prostaglandin pellets are placed in the pockets to induce angiogenesis. The test compound is administered intraperitoneally for 5 days, at which time the animal is sacrificed. The effect of the test compound is evaluated by periodically taking a photo of the limbus and considering it. The area of the neovascular response is calculated using the limbus, and thus the border angiogenesis area is calculated. Reduction of angiogenesis area compared to a suitable control indicates that the test compound is effective for reducing or inhibiting angiogenesis.
[353] Angiogenesis models used to assess the effect of test compounds in preventing angiogenesis processes are described in Min et al., Canc. Res. 56: 2428-2433 (1996). Matrigel mixtures containing bFGF as an angiogenesis-inducing agent are injected subcutaneously into C57BL6 mice in the presence and absence of test compounds. After 5 days, animals are sacrificed and photographs of Matrigel plugs that can visualize angiogenesis are taken. Experimental animals administered Matrigel and an effective amount of test compound exhibited less angiogenesis than control animals or experimental animals administered a less effective or no effective dose of compound.
[354] In vivo systems designed to determine the ability of test compounds to limit the spread of primary tumors are described in Crowley et al., Proc. Natl. Acad. Sci. 90: 5021-5025 (1993)]. Nude mice are injected with tumor cells (PC3) engineered to express CAT (chloramphenicol acetyltransferase). The compound to be tested is administered to the animal to determine its ability to reduce tumor size and / or metastasis, followed by subsequent measurement of tumor size and / or metastatic growth. In addition, the level of CAT detected in various organs provides an indication of the ability of the test compound to inhibit metastasis, and less CAT is detected in the tissues of treated animals compared to control animals, resulting in CAT-expression shifted to these tissues. Indicates that there are few cells.
[355] Using in vivo tumor cell line F3II, which is known to be highly invasive, we have devised an in vivo experimental approach to assess the inhibitory efficacy of a test serine protease inhibitor. Alonso et al., Breast Canc. Res. Treat. 40: 209-223 (1996). This document describes in vivo studies on toxicity determination, tumor growth, invasiveness, spontaneous metastasis, experimental lung metastasis and angiogenesis assays.
[356] The CAM model first described in L. Ossowski in 1998 (J. Cell. Biol. 107: 2437-2445 (1988)) is another embryo for evaluating the inhibitory activity of test compounds. In the CAM model, tumor cells invade through the chorionic villus containing CAM, where tumor cells in the presence of several serine protease inhibitors have reduced or no invasion through these membranes. Is performed using CAMs and tumor cells in the presence and absence of various concentrations of test compounds .. Invasiveness of tumor cells is measured under conditions indicative of the inhibitory activity of the compounds. Has something to do with
[357] The CAM model is also used for standard assays of angiogenesis (ie, effects on new angiogenesis) (Brooks et al., Methods in Molecular Biology 129: 257-269 (1999)). According to this model, a filter disc containing an angiogenic inducer such as basic fibroblast growth factor (bFDG) is placed on the CAM. Diffusion of cytokines into the CAM induces local angiogenesis, which can be measured in several ways, such as by counting the number of blood vessel branching points in the CAM just below the filter disc. This model can be used to test the ability of the identified compounds to inhibit cytokine-derived angiogenesis. Test compounds may be added to the filter discs containing the angiogenic derivatives, placed directly on the membrane or administered systemically. The degree of new blood vessel formation in the presence and / or absence of the test compound can be compared using this model. The formation of fewer new blood vessels in the presence of the test compound will indicate anti-angiogenic activity. Demonstrating anti-angiogenic activity against inhibitors of MTSP9 polypeptide indicates a role in angiogenesis for the SP protein.
[358] b. Known Serine Protease Inhibitors
[359] Compounds for screening may be serine protease inhibitors and may be tested for their ability to inhibit the activity of MTSP9. Examples of serine protease inhibitors for use in screening assays include serine protease inhibitors (SPI-3) [Chen, et al. Citokine, 11: 856-862 (1999); Aprotinin (Lijima, R., et al., J. Biochem. (Tokyo) 126: 912-916 (1999); Kazal-type serine protease inhibitor-like protein [Niimi, et al. Eur. J. Biochem., 266: 282-292 (1999); Kunitz-type serine protease inhibitors [see Ravichandran, S., et al., Acta Crystallogr. D. Biol. Crystallogr., 55: 1814-1821 (1999); Tissue Factor Pathway Inhibitor-2 / Matrix-Associated Serine Protease Inhibitors (TFPI-2 / MSPI). Liu, Y. et al. Arch. Biochem. Biophys. 370: 112-8 (1999); Bukinin [Cui, C. Y. et al. J. Invest. Dermatol. 113: 182-8 (1999); Naphmostat mesylate [Ryo, R. et al. Vox Sang. 76: 241-6 (1999); TPCK [Huang et al. Oncogene 18: 3431-3439 (1999); Synthetic nameless-bound serine protease inhibitors [Edwards et al. Wound Repair Regen. 7: 106-18 (1999); FUT-175 [Sawada M. et al. Stroke 30: 644-50 (1999); Combination of serine protease inhibitor FUT-0175 with thromboxane synthetase inhibitor OKY-046 [Kaminogo et al. Neurol. Med. Chir. (Tokyo) 38: 704-8; discussion 708-9 (1998); Rat Serine Protease Inhibitor 2.1 Gene [LeCam, A., et al., Biochem. Biophys. Res. Commun., 253: 311-4 (1998); New intracellular serine protease inhibitors expressed in the rat pituitary gland complex with Granzyme B. Hill et al. FEBS Lett. 440: 361-4 (1998); 3,4-dichloroisocoumarin [Hammed et al. Proc. Soc. Exp. Biol. Med., 219: 132-7 (1998); LEX032 [Bains et al. Eur. J. Pharmacol. 356: 67-72 (1998); N-tosyl-L-phenylalanine chloromethyl ketone [Dryjanski et al. Biochemistry 37: 14151-6 (1998); Mouse gene for the serine protease inhibitor neuroserpin (P112). Berger et al. Gene, 214: 25-33 (1998); Rat serine protease inhibitor 2.3 gene [Paul et al. Eur. J. Biochem. 254: 538-46 (1998); Ecotin [Yang et al. J. Mol. Biol. 279: 945-57 (1998); 14 kDa plant-related serine protease inhibitors [Roch et al. Dev. Comp. Immunol. 22 (1): 1-12 (1998); Matrix-associated serine protease inhibitor TFPI-2 / 33 kDa MSPI [Rao et al. Int. J. Cancer 76: 749-56 (1998); ONO-3403 by Hiwasa et al. Cancer Lett. 126: 221-5 (1998); Vdelastasin [Moser et al. Eur. J. Biochem. 253: 212-20 (1998); Bikunin [Xu et al. J. Mol. Biol. 276: 955-66 (1998); Napamostat mesylate [Mellgren et al. Thromb. Haemost. 79: 342-7 (1998); Growth hormone dependent serine protease inhibitor, Spi 2.1 [Maake et al. Endocrinology 138: 5630-6 (1997); Growth factor activator inhibitor type 2, Kunitz-type serine protease inhibitor [Kawaguchi et al. J. Biol. Chem., 272: 27558-64 (1997); Desert locust, a heat stable serine protease inhibitor from ovaries of Schistocerga gregaria. Hamdaoui et al. Biochem. Biophys. Res. Commun. 238: 357-60 (1997); Human placental hepatocyte growth factor activator inhibitor, Kunitz-type serine protease inhibitor [Shimomura et al. J. Biol. Chem. 272: 6370-6 (1997); FUT-187, an oral serine protease inhibitor [Shiozaki et al. Gan To Kaguku Ryoho, 23 (14): 1971-9 (1996); Extracellular matrix-associated serine protease inhibitors (Mr 33,000, 31,000, and 27,000 (Rao, CN, et al., Arch. Biochem. Biophys., 335: 82-92 (1996)); irreversible isocmarin serine Protease inhibitors [Palencia, DD, et al., Biol. Reprod., 55: 536-42 (1996); 4- (2-aminoethyl) -benzenesulfonyl fluoride (AEBSF) [Nakabo et al. J. Leukoc. Biol. 60: 328-36 (1996); Neuroserpin (Osterwalder, T., et al., EMBO J. 15: 2944-53 (1996)); human serine Protease inhibitor alpha-1-antitrypsin (Forney et al. J. Parasitol., 82: 496-502 (1996)); rat serine protease inhibitor 2.3 [Simar-Blanchet, AE, et al., Eur. J. Biochem 236: 638-48 (1996)]; gebacate mesylate (parodi, F., et al., J. Cardiothorac. Vasc. Anesth. 10: 235-7 (1996)]; recombinant serine protease Inhibitors, CPTI II (Stankiewicz, M., et al., (Acta Biochim. Pol., 43 (3): 525-9 (1996)); Stain-rich serine protease inhibitors (Guamerin 11) (Kim, DR, et al., J. Enzym. Inhib., 10: 81-91 (1996)); diisopropylfluorophosphate [Lundqvist, H] , et al., Inflamm. Res., 44 (12): 510-7 (1995); Nexin 1 (Yu, DW, et al., J. Cell Sci., 108 (Pt 12) : 3867-74 (1995); LEX032 (Scalia, R., et al., Shock, 4 (4): 251-6 (1995)); Protease nexin 1 [see Houenou, L. J., et al., Proc. Natl. Acad. Sci. U. S. A., 92 (3): 895-9 (1995); Kinase-directed serine protease inhibitors (Woodard S. L., et al., J. Immunol., 153 (11): 5016-25 (1994)); N-alpha-tosyl-L-lysyl-chloromethyl ketone (TLCK) (Bourinbaiar, A. S., et al., Cell Immunol., 155 (1): 230-6 (1994)); Smpi 56 [Ghendler, Y., et al., Exp. Parasitol., 78 (2): 121-31 (1994); Shistosoma haematobium serine protease [Blanton, R. E., et al., Mol. Biochem. Parasitol., 63 (1): 1-11 (1994); Spi-1 [Warren, W. C., et al., Mol. Cell Endocrinol., 98 (1): 27-32 (1993); TAME (Jessop, J. J., et al., Inflammation, 17 (5): 613-31 (1993)); Antithrombin III [Kalaria, R. N., et al., Am. J. Pathol., 143 (3): 886-93 (1993); FOY-305 (Ohkoshi, M., et al., Anticancer Res., 13 (4): 963-6 (1993)); Chamostat mesylate [Senda, S., et al., Intern. Med., 32 (4): 350-4 (1993); Pigment epithelium-derived factors [Steele, F. R., et al., Proc. Natl. Acad. Sci. U. S. A., 90 (4): 1526-30 (1993); Antistatin (Holstein, T. W., et al., FEBS Lett., 309 (3): 288-92 (1992)); Vaccinia virus K2L gene encoding a serine protease inhibitor (Zhou, J., et al., Virology, 189 (2): 678-86 (1992)); Bowman-Birk serine protease inhibitors [Werner, M. H., et al., J. Mol. Biol., 225 (3): 873-89 (1992); FUT-175 (Yanamoto, H., et al., Neurosurgery, 30 (3): 358-63 (1992)); FUT-175 (Yanamoto, H., et al., Neurosurgery, 30 (3): 351-6, discussion 356-7 (1992)); PAI-I [Yreadwell, B. V., et al., J. Orthop. Res., 9 (3): 309-16 (1991); 3,4-dichloroisocoumarin (Rusbridge, N. M., et al., FEBS Lett., 268 (1): 133-6 (1990)); Alpha 1-antichymotrypsin [Lindmark, B. E., et al., Am. Rev. Respir. Des., 141 (4 Pt1): 884-8 (1990); P-toluenesulfonyl-L-arginine methyl ester (TAME) (Scuderi, P., J. Immunol., 143 (1): 168-73 (1989)); Alpha 1-antichymotrypsin (Abraham, C. R., et al., Cell, 52 (4): 487-501 (1988)); Contrapsin (Modha, J., et al., Parasitology, 96 (Pt 1): 99-109 (1988)); Alpha 2-antiplasmin [Holmes, W. E., et al., J. Biol. Chem., 262 (4): 1659-64 (1987); 3,4-dichloroisocoumarin (Harper, J. W., et al., Biochemistry, 24 (8): 1831-41 (1985)); Diisopropylfluorophosphate [Tsutsui, K., et al., Biochem. Biophys. Res. Commun., 123 (1): 271-7 (1984); Gabexate mesylate [Hesse, B., et al., Pharmacol. Res. Commun., 16 (7): 637-45 (1984); Phenyl methyl sulfonyl fluoride [Dufer, J., et al., Scand. J. Haematol., 32 (1): 25-32 (1984); Protease inhibitor CI-2 [McPhalen, C. A., et al., J. Mol. Biol., 168 (2): 445-7 (1983); Phenylmethylsulfonyl fluoride [Sekar V., et al., Biochem. Biophys. Res. Commun., 89 (2): 474-8 (1979); PGE1 (Feinstein, M. D., et al., Prostaglandine, 14 (6): 1075-93 (1977)), but is not limited thereto.
[360] c. Combination library and other libraries
[361] Sources of compounds for screening assays can be libraries including, but not limited to, combinatorial libraries. Methods of synthesizing combinatorial libraries and features of such combinatorial libraries are known in the art. See Combinatorial Libraries: Synthesis, Screening and Application Potential (Cortese Ed.) Walter de Gruyter, Inc., 1995; Tietze and Lieb, Curr. Opin. Chem. Biol., 2 (3): 363-71 (1998); Lam, Anticancer Drug Des., 12 (3): 145-67 (1997); Blaney and Martin, Curr. Opin. Chem. Biol., 1 (1): 54-9 (1997); and Schultz and Schultz, Biotechnol. Prog., 12 (6): 729-43 (1996).
[362] Molecular biology methods and / or co-chemical synthesis methodologies have been used to develop methods and strategies for generating a variety of libraries, primarily peptide-based and nucleotide-based oligomer libraries. See Dower et al., Annu. Rep. Med. Chem., 26: 271-280 (1991); Fodor et al., Science, 251: 767-773 (1991); Jung et al., Angew. Chem. Ind. Ed. Engl., 31: 367-383 (1992); Zuckerman et al., Proc. Natl. Acad. Sci. USA, 89: 4505- 4509 (1992); Scott et al., Science, 249: 386-390 (1990); Devlin et al., Science, 249: 404-406 (1990); Cwirla et al., Proc. Natl. Acad. Sci. USA, 87: 6378-6382 (1990); and Gallop et al., J. Medicinal Chemistry, 37: 1233-1251 (1994). The resulting combinatorial library potentially contains millions of compounds and can be screened to identify compounds exhibiting selected activity.
[363] Libraries fall into roughly three categories: fusion-protein-labeled peptide libraries in which random peptides or proteins are present on the surface of phage particles or proteins expressed from plasmids; Individual compounds or mixtures of compounds may be insoluble matrices such as resin beads (Lam et al., Nature, 354: 82-84 (1991)) and cotton supports (Eichler et al., Biochemistry 32: 11035-11041 (1993); support-bound synthetic chemical libraries present on; And methods in which compounds are used in solution (Houghten et al., Nature, 354: 84-86 (1991); Houghten et al., BioTechniques, 313: 412-421 (1992); and Scott et al., Curr. Opin. Biotechnol., 5: 40-48 (1994)]. There are numerous examples of synthetic peptide and oligonucleotide combination libraries, and there are many ways to prepare libraries containing non-peptidic small organic molecules. Such libraries may be based on a set of reference monomers that combine to form a mixture of various organic molecules or combine to form a library based on selected pharmacophore monomers.
[364] Random or deterministic combinatorial libraries can be screened by the methods described herein and / or the claimed screening methods. In either of these two libraries, each unit of the library is separated and / or immobilized on a solid support. In deterministic libraries, the location of specific units on each solid support is known above. In random libraries, the location of specific units is not previously known, but each site still contains a unique single unit. Many methods for preparing libraries are known to those skilled in the art. See Geysen et al., Proc. Natl. Acad. Sci. USA, 81: 3998-4002 (1984), Houghten et al., Proc. Natl. Acad. Sci. USA, 81: 5131-5135 (1985). Combinatorial libraries generated by all techniques known to those skilled in the art are contemplated for screening. Table 1 of Schultz and Schultz, Biotechnol. Prog., 12 (6): 729-43 (1996); Bartel et al., Science, 261: 1411-1418 (1993); Baumbach et al. BioPharm, (Can): 24-35 (1992); Bock et al. Nature, 355: 564-566 (1992); Borman, S., Combinatorial chemists focus on samll molecules molecular recognition, and automation, Chem. Eng. News, 2 (12): 29 (1996); Boublik, et al., Eukaryotic Virus Display: Engineering the Major Surface Glycoproteins of the Autographa California Nuclear Polyhedrosis Virus (ACNPV) for the Presentation of Foreign Proteins on the Virus Surface, Bio / Technology, 13: 1079-1084 (1995); Brenner, et al., Encoded Combinatorial Chemistry, Proc. Natl. Acad Sci. U.S.A., 89: 5381-5383 (1992); Caflisch, et al., Computational Combinatorial Chemistry for De Novo Ligand Design: Review and Assessment, Perspect. Drug Discovery Des., 3: 51-84 (1995); Cheng, et al., Sequence-Selective Peptide Binding with a Peptido-A, B-trans-steroidal Receptor Selected from an Encoded Combinatorial Library, J. Am. Chem. Soc., 118: 1813-1814 (1996); Chu, et al., Affinity Capillary Electrophoresis to Identify the Peptide in A Peptide Library that Binds Most Tightly to Vancomycin, J. Org. Chem., 58: 648-652 (1993); Clackson, et al., Making Antibody Fragments Using Phage Display Libraries, Nature, 352: 624-628 (1991); Combs, et al., Protein Structure-Based Combinatorial Chemistry: Discovery of Non-Peptide Binding Elements to Src SH3 Domain, J. Am. Chem. Soc., 118: 287-288 (1996); Cwirla, et al., Peptides On Phage: A Vast Library of Peptides for Identifying Ligands, Proc. Natl. Acad. Sci. U.S.A., 87: 6378-6382 (1990); Ecker, et al., Combinatorial Drug Discovery: Which Method will Produce the Greatest Value, Bio / Technology, 13: 351-360 (1995); Ellington, et al., In Vitro Selection of RNA Molecules That Bind Specific Ligands, Nature, 346: 818-822 (1990); Ellman, J. A., Variants of Benzodiazephines, J. Am. Chem. Soc., 114: 10997 (1992); Erickson, et al., The Proteins; Neurath, H., Hill, R. L., Eds .: Academic: New York, 1976; pp. 255-257; Felici, et al., J. Mol. Biol., 222: 301-310 (1991); Fodor, et al., Light-Directed, Spatially Addressable Parallel Chemical Synthesis, Science, 251: 767-773 (1991); Francisco, et al., Transport and Anchoring of Beta-Lactamase to the External Surface of E. Coli., Proc. Natl. Acad. Sci. U.S.A., 89: 2713-2717 (1992); Georgiou, et al., Practical Applications of Engineering Gram-Negative Bacterial Cell Surfaces, TIBTECH, 11: 6-10 (1993); Geysen, et al., Use of peptide synthesis to probe viral antigens for epitopes to a resolution of a single amino acid, Proc. Natl. Acad. Sci. U.S.A., 81: 3998-4002 (1984); Glaser, et al., Antibody Engineering by Condon-Based Mutagenesis in a Filamentous Phage Vector System, J. Immunol., 149: 3903-3913 (1992); Gram, et al., In vitro selection and affinity maturation of antibodies from a naive combinatorial immunoglobulin library, Proc. Natl. Acad. Sci., 89: 3576-3580 (1992); Han, et al., Liquid-Phase Combinatorial Synthesis, Proc. Natl. Acad. Sci. U.S.A., 92: 6419-6423 (1995); Hoogenboom, et al., Multi-Subunit Proteins on the Surface of Filamentous Phage: Methodologies for Displaying Antibody (Fab) Heavy and Light Chains, Nucleic Acids Res., 19: 4133-4137 (1991); Houghten, et al., General Method for the Rapid Solid-Phase Synthesis of Large Numbers of Peptides: Specificity of Antigen-Antibody Interaction at the Level of Individual Amino Acids, Proc. Natl. Acad. Sci. U.S.A., 82: 5131-5135 (1985); Houghten, et al., The Use of Synthetic Peptide Combinatorial Libraries for the Determination of Peptide Ligands in Radio-Receptor Assays-Opiod-Peptides, Bioorg. Med. Chem. Lett., 3: 405-412 (1993); Houghten, et al., Generation and Use of Synthetic Peptide Combinatorial Libraries for Basic Research and Drug Discovery, Nature, 354: 84-86 (1991); Huang, et al., Discovery of New Ligand Binding Pathways in Myoglobin by Random Mutagenesis, Nature Struct. Biol., 1: 226-229 (1994); Huse, et al., Generation of a Large Combinatorial Library of the Immunoglobulin Repertoire In Phage Lambda, Science, 246: 1275-1281 (1989); Janda, K. D., New Strategies for the Design of Catalytic Antibodies, Biotechnol. Prog., 6: 178-181 (1990); Jung, et al., Multiple Peptide Synthesis Methods and Their Applications, Angew. Chem. Int. Ed. Engl., 31: 367-486 (1992); Kang, et al., Linkage of Recognition and Replication Functions By Assembling Combinatorial Antibody Fab Libraries Along Phage Surfaces, Proc. Natl. Acad. Sci. U.S.A., 88: 4363-4366 (1991a); Kang, et al., Antibody Redesign by Chain Shuffling from Random Combinatorial Immunoglobulin Libraries, Proc. Natl. Acad. Sci. U.S.A., 88: 11120-11123 (1991b); Kay, et al., An M13 Phage Library Displaying Random 38-Amino-Acid-Peptides as a Source of Novel Sequences with Affinity to Selected Targets Genes, Gene, 128: 59-65 (1993); Lam, et al., A new type of synthetic peptide library for identifying ligand-binding activity, Nature, 354: 82-84 (1991) (published errata apear in Nature, 358: 434 (1992) and Nature, 360: 768 ( Lebl, et al., One Bead One Structure Combinatorial Libraries, Biopolymers (Pept. Sci.), 37: 177-198 (1995); Lerner, et al., Antibodies without Immunization, Science, 258: 1313-1314 (1992); Li, et al., Minimization of a Polypeptide Hormone, Science, 270: 1657-1660 (1995); Light, et al., Display of Dimeric Bacterial Alkaline Phosphatase on the Major Coat Protein of Filamentous Bacteriophage, Bioorg. Med. Chem. Lett., 3: 1073-1079 (1992); Little, et al., Bacterial Surface Presentation of Proteins and Peptides: An Alternative to Phage Technology, Trends Biotechnol., 11: 3-5 (1993); Marks , et al., By-Passing Immunization.Human Antibodies from V-Gene Libraries Displayed on Phage, J. Mol. Biol., 222: 581-597 (1991); Matthews, et al., Substrate Phage: Selection of Protease Substrates by Monovalent Phage Display, Science, 260: 1113-1117 (1993); McCafferty, et al., Phage Enzymes: Expression and Affinity Chromatography of Functional Alkaline Phosphatase on the Surface of Bacteriophage, Protein Eng., 4: 955-961 (1991); Menger, et al., Phosphatase Catalysis Developed Via Combinatorial Organic Chemistry, J. Org. Chem., 60: 6666-6667 (1995); Nicolaou, et al., Angew. Chem. Int. Ed. Engl., 34: 2289-2291 (1995); Oldenburg, et al., Peptide Ligands for A Sugar-Binding Protein Isolated from a Random Peptide Library, Proc. Natl. Acad. Sci. U.S.A., 89: 5393-5397 (1992); Parmley, et al., Antibody-Selectable Filamentous fd Phage Vectors: Affinity Purification of Target Genes, Genes, 73: 305-318 (1988); Pinilla, et al., Synthetic Peptide Combinatorial Libraries (SPCLS)-Identification of the Antigenic Determinant of Beta-Endorphin Recognized by Monoclonal Antibody-3E7, Gene, 128: 71-76 (1993); Pinilla, et al., Review of the Utility of Soluble Combinatorial Libraries, Biopolymers, 37: 221-240 (1995); Pistor, et al., Expression of Viral Hemegglutinan On the Surface of E. Coli., Klin. Wochenschr., 66: 110-116 (1989); Pollack, et al., Selective Chemical Catalysis by an Antibody, Science, 234: 1570-1572 (1986); Rigler, et al., Fluorescence Correlations, Single Molecule Detection and Large Number Screening: Applications in Biotechnology, J. Biotechnol., 41: 177-186 (1995); Sarvetnick, et al., Increasing the Chemical Potential of the Germ-Line Antibody Repertoire, Proc. Natl. Acad. Sci. U.S.A., 90: 4008-4011 (1993); Sastry, et al., Cloning of the Immunological Repertiore in Escherichia Coli for Generation of Monoclonal Catalytic Antibodies: Construction of a Heavy Chain Variable Region-Specific cDNA Library, Proc. Natl. Acad. Sci. U.S.A., 86: 5728-5732 (1989); Scott, et al., Searching for Peptide Ligands with an Epitope Library, Science, 249: 386-390 (1990); Sears, et al., Engineering Enzymes for Bioorganic Synthesis: Peptide Bond Formation, Biotechnol. Prog., 12: 423-433 (1996); Simon, et. al., Peptides: A Modular Approach to Drug Discovery, Proc. Natl. Acad. Sci. U.S.A., 89: 9367-9371 (1992); Still, et al., Discovery of Sequence-Selective Peptide Binding by Synthetic Receptors Using Encoded Combinatorial Libraries, Acc. Chem. Res., 29: 155-163 (1996); Thompson, et al., Synthesis and Applications of Small Molecule Libraries, Chem. Rev., 96: 555-600 (1996); Tramontano, et al., Catalytic Antibodies, Science, 234: 1566-1570 (1986); Wrighton, et al., Small Peptides as Potent Mimetics of the Protein Hormone Erythropoietin, Science, 273: 458-464 (1996); York, et al., Combinatorial mutagenesis of the reactive site region in plasminogen activator inhibitor I, J. Biol. Chem., 266: 8595-8600 (1991); Zebedee, et al., Human Combinatorial Antibody Libraries to Hepatitis B Surface Antigen, Proc. Natl. Acad. Sci. U.S.A., 89: 3175-3179 (1992); Zuckerman, et al., Identification of Highest-Affinity Ligands by Affinity Selection from Equimolar Peptide Mixtures Generated by Robotic Synthesis, Proc. Natl. Acad. Sci. U.S.A., 89: 4505-4509 (1992).
[365] For example, a peptide that binds to the MTSP9 polypeptide, or protease domain of the SP protein, can be identified using phage display libraries. In an exemplary embodiment, the method comprises the steps of: a) contacting a phage from a phage library with an MTSP9 polypeptide or a protease domain thereof; b) isolating phage binding to the protein; And c) determining the identity of one or more peptides encoded by the isolated phages to identify peptides that bind MTSP9 polypeptides.
[366] H. Activity Modulators of MTSP9 Polypeptides
[367] Provided herein are compounds that modulate the activity of MTSP9, generated using the MTSP9 polypeptide or protease domain or identified by screening in other screening methods. These compounds act by directly interacting with the MTSP9 polypeptide or by altering their transcription or translation. Such molecules include antibodies that specifically react with MTSP9 polypeptides, particularly their protease domains; Antisense nucleic acids or double-stranded RNA (dsRNA) that change the expression of the MTSP9 polypeptide, such as, but not limited to, RNAi, antibodies, peptide mimetics and other compounds.
[368] 1. Antibodies
[369] Provided herein are antibodies comprising a polyclonal and monoclonal antibody specifically binding to an MTSP9 polypeptide, particularly its single-chain protease domain, or an active form or simogen form of a full length or protease domain.
[370] In general, the antibody is a monoclonal antibody, and typically the antibody specifically binds to the protease domain of the MTSP9 polypeptide. In certain embodiments, an antibody against each of the single and / or double strands of the protease domain of MTSP9 is provided. Also provided are antibodies that specifically bind to all domains of MTSP9 and their double-stranded forms.
[371] MTSP9 polypeptides, and domains, fragments, homologs and derivatives thereof, can be used as immunogens to generate antibodies that specifically bind to these immunogens. Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, and Fab expression libraries. In certain embodiments, antibodies against human MTSP9 polypeptides are generated. In another embodiment, a complex formed from a fragment of MTSP9 polypeptide containing a serine protease domain is used as an immunogen for antibody production.
[372] Various procedures known in the art can be used to generate polyclonal antibodies against MTSP9 polypeptides, domains, derivatives, fragments or homologues thereof. To produce antibodies, various host animals can be immunized by injecting a native MTSP9 polypeptide, or a synthetic form or derivative thereof, such as a crosslinked MTSP9 polypeptide. Such host animals include, but are not limited to, rabbits, mice, rats, and the like. Various adjuvants may be used to increase the immunological response depending on the host species, including Freund (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lithore , Pluronic polyols, polyanions, peptides, oil emulsions, dinitrophenols, and potentially useful human adjuvant such as Bacilles galmete-gerang (BCG) and corynebacterium parvum Include, but are not limited to.
[373] In order to prepare the monoclonal antibodies directed against the MTSP9 polypeptide, or domains, derivatives, fragments or homologues thereof, any technique that provides for the production of antibody molecules by continuous cell lines in culture can be used. Such techniques include hybridoma technology, trioma technology, human B-cell hybridoma technology first developed by Kohler and Milstein (Nature 256: 495-497 (1975)). Kozbor et al., Immunology Today 4: 72 (1983), and EBV hybridoma technology to generate human monoclonal antibodies (Cole et al., In Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc.). ., pp. 77-96 (1985), but is not limited thereto. In an additional embodiment, monoclonal antibodies can be produced in sterile animals utilizing the latest technology (PCT / US90 / 02545). Human antibodies can be used, using human hybridomas or by Cote et al., Proc. Natl. Acad. Sci. USA 80: 2026-2030 (1983)] or by transforming human B cells with EBV virus in vitro [Col et al., In Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96 (1985)]. Genes from mouse antibody molecules specific for the MTSP9 polypeptide are spliced together with genes from human antibody molecules of appropriate biological activity to produce "chimeric antibodies" (Morris et al., Proc. Natl. Acad. Sci. USA 81: 6851-6855 (1984); Neuberger et al., Nature 312: 604-608 (1984); Takeda et al., Nature 314: 452-454 (1985).
[374] MTSP9-encoding nucleic acid molecules or portions thereof can be used in DNA immunization protocols that produce antibodies that bind MTSP9 (see US Pat. No. 5,795,872 and US Pat. No. 5,643,578 and US Pat. No. 6,337,072).
[375] Techniques described for the production of single chain antibodies (US Pat. No. 4,946,778) can be modified to generate MTSP9 polypeptide-specific single chain antibodies. Additional embodiments use the techniques described for the construction of Fab expression libraries (Hues et al., Science 246: 1275-1281 (1989)) to produce the desired specificity for the MTSP9 polypeptide or domain, derivative or homologue thereof. The monoclonal Fab fragment with can be identified quickly and easily. Non-human antibodies can be "humanized" by known methods (see US Pat. No. 5,225,539).
[376] Antibody fragments that specifically bind MTSP9 polypeptide or epitopes thereof can be generated by techniques known in the art. For example, such fragments include F (ab ') 2 fragments that can be produced by pepsin digesting antibody molecules; Fab 'fragments that can be produced by reducing the disulfide bridges of such F (ab') 2 fragments; Fab fragments that can be produced by treating antibody molecules with papain and reducing agents, and Fv fragments are included, but are not limited to these.
[377] In generating antibodies, screening for the antibody of interest can be performed by techniques known in the art, such as ELISA (enzyme linked immunosorbent assay). In order to select antibodies specific for specific domains of the MTSP9 polypeptide, hybridomas can be generated for products that bind fragments of the MTSP9 polypeptide containing these domains.
[378] The antibodies described above can be used in methods known in the art, such as in the art, in connection with the localization and / or quantification of MTSP9 polypeptide proteins, and for determining their level in a suitable physiological sample, for example, by diagnostic methods. It can be used in the measuring method. In another embodiment, an anti-MTSP9 polypeptide antibody or fragment thereof containing a binding domain is used as a therapeutic agent.
[379] 2. Peptides, Polypeptides and Peptide Mimetics
[380] Provided herein are methods for identifying molecules that modulate and bind the activity of SP proteins. Among these, the molecules that bind SP, in particular its single-chain protease domain or catalytically active fragments, are peptides, polypeptides and peptide mimetics (including cyclic peptides). Peptide mimetics are molecules or compounds that mimic the molecular conformation of a ligand or polypeptide that is essential for specifically binding to a target molecule, such as an MTSP9 polypeptide. In an exemplary embodiment, the peptide, peptide, polypeptide and peptide mimetic (s) are associated with a protease domain of MTSP9 polypeptide. Such peptides and peptide mimetics include those of antibodies that specifically bind to the MTSP9 polypeptide and typically bind to the protease domain of the MTSP9 polypeptide. Peptides, polypeptides and peptide mimetic (s) identified by the methods provided herein can be agonists or antagonists of the MTSP9 polypeptide.
[381] The peptides, polypeptides and peptide mimetics are useful for diagnosing, treating, preventing and screening diseases or disorders associated with MTSP9 polypeptide activity in mammals. In addition, the peptides and peptide mimetics are useful for modulating the activity of MTSP9 polypeptides or for identifying, isolating, and purifying molecules or compounds that specifically bind to the protease domain of MTSP9 polypeptides, generally MTSP9 polypeptides. Low molecular weight peptides and peptide mimetics can have strong binding properties with a target molecule, eg, an MTSP9 polypeptide or a protease domain of MTSP9 polypeptide.
[382] Peptides, polypeptides and peptide mimetics that bind MTSP9 polypeptides as described herein can be administered to mammals, including humans, to modulate MTSP9 polypeptide activity. Thus, methods are provided for treating and preventing neoplastic diseases, including administering a peptide, polypeptide or peptide mimetic compound in an amount sufficient to modulate the activity. Accordingly, also provided herein are methods for treating a subject with a disease or disorder, wherein the peptide, polypeptide or peptide mimetic compound is administered to the subject in a therapeutically effective dose or amount.
[383] Compositions containing such peptides, polypeptides or peptide mimetics can be administered for prophylactic and / or therapeutic treatments. For therapeutic application, the composition may be administered to a patient suffering from a disease as mentioned above in an amount sufficient to treat such disease and complications, or at least partially inhibiting its symptoms. The amount effective for this use will depend on the severity of the disease and the weight and health of the patient, which can be determined experimentally.
[384] For prophylactic applications, the compositions containing the peptides, polypeptides and peptide mimetics are administered to patients susceptible to or at risk of certain diseases. This amount is defined as "prophylactically effective dose". The exact amount for this use depends on the patient's state of health and weight. Thus, peptides, polypeptides and peptide mimetics that bind MTSP9 polypeptides can be used to prepare pharmaceutical compositions containing, as active ingredient, one or more such peptides or peptide mimetics with pharmaceutical carriers or diluents. The compound may be, for example, oral, pulmonary, parenteral (intramuscular, intraperitoneal, intravenous (IV) or subcutaneous injection), inhalation (via a fine powder formulation), subcutaneous, intranasal, intravaginal, rectal or sublingual route of administration. And can be formulated in a suitable dosage form for each route of administration. See PCT Publications WO 93/25221 and WO 94/17784; And European Patent Application 613,683.
[385] Peptides, polypeptides and peptide mimetics that bind to MTSP9 polypeptides are useful in vitro as unique tools for understanding the biological role of MTSP9 polypeptides, which affect and are affected by the production of MTSP9 polypeptides. It involves evaluating many factors that are considered. The peptides, polypeptides and peptide mimetics are also useful for the development of other compounds that modulate and bind the activity of MTSP9 polypeptides, which provide important information about the correlation between the structures and activities in which the compounds promote this development. Because of giving.
[386] The peptides, polypeptides and peptide mimetics are also useful as competitive binders in assays for screening for new MTSP9 polypeptides or MTSP9 polypeptide agonists. In such assay embodiments, the compound can be used without modification, or can be modified in a variety of ways, for example by labeling residues directly or indirectly, eg, by covalent or non-covalent linkages. It provides a detectable signal. In all of these embodiments, the substance for this can be labeled either directly or indirectly. Allowing direct labeling includes labeling groups such as radiolabels such as ¹²⁵ I enzymes (US Pat. No. 3,645,090) such as peroxidase and alkaline phosphatase; And fluorescent labels (US Pat. No. 3,940,475) capable of monitoring changes in fluorescence intensity, wavelength shift, or fluorescence fluorescent light. Enabling indirect labeling includes biotinylating one member and then binding to avidin coupled with one of the labeling groups. If the compound is to be attached to a solid support, the compound may comprise a spacer or a linker.
[387] Furthermore, based on their ability to bind MTSP9 polypeptides, the peptides, polypeptides and peptide mimetics can be used as reagents for detecting MTSP9 polypeptides in living cells, fixed cells, biological fluids, liposomes, and purified natural biological materials. Can be used. For example, by labeling such peptides, polypeptides and peptide mimetics, cells with MTSP9 polypeptides can be identified. Further, based on their ability to bind MTSP9 polypeptides, the peptides, polypeptides and peptide mimetics can be used for in situ staining, FACS (fluorescence-activated cell sorting), western blotting, ELISA and other assay protocols. Based on their ability to bind MTSP9 polypeptides, the peptides, polypeptides and peptide mimetics can be used to purify MTSP9 polypeptide (s) or to encode polypeptides encoding the protease domain of MTSP9 polypeptide (s), eg, MTSP9 polypeptide. Can be used to purify the expressing cells.
[388] The peptides, polypeptides and peptide mimetics can also be used as commercial reagents for use in a variety of medical research and diagnostic uses. The activity of peptides and peptide mimetics is described by McDonald (1992) Am. J. of Pediatric Hematology / Oncology, 14: 8-21] can be evaluated in vivo or in vitro in one of a number of models.
[389] 3. Peptides, Polypeptides and Peptide Mimetics
[390] Peptide homologs are commonly used in the pharmaceutical industry as non-peptide drugs with properties similar to template peptides. These types of non-peptide compounds are referred to as "peptide mimetics" or "peptido mimetics". Luthman et al., A Textbook of Drug Design and Development, 14: 386-406, 2nd Ed., Harwood Academic Publishers (1996); Joachim Grante (1994) Angew. Chem. Int. Ed. Engl., 33: 1699-1720; Fauchere (1986) J. Adv. Drug Res., 15:29; Veber and Freidinger (1985) TINS, p. 392; and Evans et al. (1987) J. Med. Chem. 30: 1229]. Peptide mimetics that are structurally similar to therapeutically useful peptides can be used to produce equivalent or enhanced therapeutic or prophylactic effects. The preparation of peptide- mimetics and their structures are known to those skilled in the art.
[391] One or more amino acids of the consensus sequence can be systematically substituted with the same type of D-amino acid (eg, by replacing L-lysine with D-lysine) to produce more stable peptides. In addition, restricted peptides containing consensus sequences or substantially identical consensus sequence modifications can be produced by methods known in the art. See Rizo et al. (1992) An. Rev. Biochem., 61: 387; Incorporated herein by reference], for example, by adding an internal cysteine residue capable of forming an intramolecular disulfide bridge that closes the peptide.
[392] One skilled in the art recognizes that the peptide and peptide mimetics can be modified without adversely affecting the biological or functional activity of the peptide. In addition, those skilled in the art are known how to design non-peptide constructs in three-dimensional form that mimic a target molecule, eg, an MTSP9 polypeptide, or a peptide that generally binds to the protease domain of an MTSP9 polypeptide. Eck and Sprang (1989) J. Biol. Chem., 26: 17605-18795.
[393] When used for diagnostic purposes, peptides and peptide mimetics can be labeled with detectable signals, so peptides and peptide mimetics that do not have such labels can serve as intermediates in preparing labeled peptides and peptide mimetics. . Detectable labels, when covalently attached to peptides and peptide mimetics, enable detection of such peptides and peptide mimetics in vivo, eg, in patients administered the peptides and peptide mimetics. Or molecules or compounds that allow detection in vitro, for example in a sample or cell. Suitable detectable labels are well known in the art and include, for example, radioisotopes, fluorescent labels (eg fluorescein) and the like. The particular detectable label used is not critical and it is chosen to be detectable at non-toxic levels. Selection of such labels is a technique well known in the art.
[394] Covalent attachment of a detectable label to a peptide or peptide mimetic is carried out by conventional methods well known in the art. For example, when using a ¹²⁵ I radioisotope as a detectable label, covalent attachment of ¹²⁵ I to a peptide or peptide mimetic is achieved by incorporating the amino acid tyrosine into the peptide or peptide mimetic and then iodinating such peptide. [Weaner et al. (1994) Synthesis and Applications of Isotopically Labeled Compounds, pp. 137-140. If tyrosine is not present in the peptide or peptide mimetics, incorporation of tyrosine into the N or C terminus of the peptide or peptide mimetics can be accomplished by well known chemistry. Likewise, ³² P can be incorporated onto the peptide or peptide mimetic as a phosphate moiety via hydroxyl groups on the peptide or peptide mimetic using conventional chemistry.
[395] Labeling the peptide mimetics typically results in non-interfering positions on the peptide mimetics expected by quantitative structure-activity data and / or molecular modeling, either directly or via a spacer (e.g., an amide group). Covalent attachment). Such non-interfering sites are generally positions that do not form direct contact with the macromolecule (s) to which the peptide mimetics bind and have a therapeutic effect. Derivatizing (eg, labeling) a peptide mimetic should not substantially interfere with the desired biological or pharmacological activity of the peptide mimetic.
[396] Peptides, polypeptides and peptide mimetics that can bind to MTSP9 polypeptide or protease domain of MTSP9 polypeptide and / or modulate its activity or exhibit MTSP9 polypeptide activity can be used in the treatment of neoplastic diseases. Such peptides, polypeptides and peptide mimetics can be delivered in vivo or ex vivo to cells of a subject in need of treatment. In addition, peptides with MTSP9 polypeptide activity can be delivered in vivo or ex vivo to cells with a missing allele or mutant encoding the MTSP9 polypeptide gene. Any technique described herein or known to those skilled in the art can be used for the preparation and delivery of the peptides, polypeptides and peptide mimetics that are substantially free of other human proteins and their in vivo or ex vivo delivery. For example, the peptides, polypeptides and peptide mimetics can be readily prepared by expression in microorganisms or by synthesis in vitro.
[397] Peptides or peptide mimetics can be introduced in vivo or ex vivo into cells, for example by microinjection or by using liposomes. Alternatively, such peptides, polypeptides or peptide mimetics can be taken up by cells in vivo or ex vivo, either actively or by diffusion. In addition, the application of peptides, polypeptides or peptide mimetics extracellularly may be sufficient to treat neoplastic diseases. Other molecules, such as drugs or organic compounds, which 1) bind to the MTSP9 polypeptide or protease domain thereof, or 2) have similar functions or activities as the MTSP9 polypeptide or protease domain thereof, can be used in the method of treatment.
[398] 4. Reasonable drug design
[399] The goal of rational drug design is, for example, to make drugs that are more active or stable, or to make drugs that enhance or interfere with the function of a polypeptide (eg, MTSP9 polypeptide) in vivo. To generate structural analogs of interacting peptide mimetics or small molecules, or structural analogs of biologically active polypeptides or peptides of interest. In one approach, first, X-ray crystallography, computer modeling or simulation of the three-dimensional structure of the protein of interest (eg, a MTSP9 polypeptide or polypeptide having a protease domain), or, for example, the three-dimensional structure of the MTSP9 polypeptide-ligand complex Typically, it is determined by a combination of approaches. See Erickson et al. 1990]. In addition, by modeling based on the structure of the homologous protein, useful information about the structure of the specific polypeptide can be obtained. In addition, alanine scans can be used to analyze peptides. In this technique, amino acid residues are replaced with Ala and its effect on the activity of the peptide is determined. Each amino acid residue of the peptide is analyzed in this manner to determine the important region of that peptide.
[400] In addition, the MTSP9 polypeptide, or in general, a polypeptide or peptide that binds to the protease domain of the MTSP9 polypeptide, can be selected by functional assays, which can then determine the crystal structure of such polypeptide or peptide. The polypeptide can be, for example, an MTSP9 polypeptide or an antibody specific for the protein domain of MTSP9 polypeptide. With this approach, a single generation of drug action that is the basis of subsequent drug design can be generated. In addition, it is possible to bypass crystallography together by generating anti-genetic polypeptides or peptides (anti-ids) for functionally pharmacologically active polypeptides or peptides that bind MTSP9 polypeptides or protease domains of MTSP9 polypeptides. As a mirror image, the binding site of the anti-ids is exposed to the original target molecule, eg, an MTSP9 polypeptide or a homologue of a polypeptide with MTSP9 polypeptide. The anti-id can then be used to identify and isolate peptides from chemically or biologically generated peptide banks. The peptide thus selected will then act as a drug action generator.
[401] Thus, for example, one can devise drugs that have improved activity or stability or that act as modulators of MTSP9 polypeptide activity (eg, inhibitors, agonists, antagonists), which can help diagnose, treat, and prevent neoplastic diseases. And screening methods. Since the nucleic acid encoding the MTSP9 polypeptide can be used, an amount of MTSP9 polypeptide (s) sufficient to perform analytical studies such as X-ray crystallography can be made available. In addition, knowledge of the amino acid sequence of the MTSP9 polypeptide or its protease domain, eg, the protease domain encoded by the amino acid sequences of SEQ ID NOs: 5 and 6, provides, instead of or in addition to X-ray crystallography, guidance for computer modeling techniques. I can do it.
[402] How to identify peptides and peptide mimetics that bind MTSP9 polypeptides
[403] Peptides having binding affinity with the MTSP9 polypeptide (s) provided herein (eg, a MTSP9 polypeptide or a polypeptide having a protease domain of MTSP9 polypeptide) can be, for example, a random peptide diversity generation system associated with an affinity enhancing process. It can be easily identified by. Specifically, random peptide diversity generation systems include "peptide on plasmid" systems (see US Pat. Nos. 5,270,170 and 5,338,665); “Peptide on Phage” systems [see, eg, US Pat. No. 6,121,238 and Cwirla, et al. (1990) Proc. Natl. Acad. Sci. U.S.A. 87: 6378-6382; "Polysome system"; "Encrypted Synthetic Library (ESL)" system; And "extreme large amounts of immobilized polymer synthesis" systems [see U.S. Pat. Patent No. 6,121,238; and Dower et al. (1991) An. Rep. Med. Chem. 26: 271-280.
[404] For example, using the procedures mentioned above, one can generally design random peptides having a defined number of amino acid residue lengths (eg, 12). To generate a collection of oligonucleotides encoding such random peptides, codon motifs (NNK) _x [where N is nucleotides A, C, G or T (equivalent; depending on the method used, other nucleotides may be used). K is G or T (equivalent) and x is an integer corresponding to the number of amino acids in the peptide (e.g., 12)], to specify any one of the 32 possible codons generated from the NNK motif. May do: one for each of the 12 amino acids, two for each of the five amino acids, three for each of the three amino acids, and only one of the three stop codons. Thus, the NNK motif encodes all amino acids, encodes only one stop codon, and reduces codon bias.
[405] The random peptide is, for example, a fusion protein having a Lacl peptide fusion protein bound to the plasmid, or as part of a fusion protein containing the pIII or pVIII coat protein of the phage fd derivative, on the surface of the phage particle, or As a peptide on the plasmid. The phage or plasmid, including the DNA encoding the peptide of interest, can be identified and separated by affinity enhancing procedures using immobilized MTSP9 polypeptide (s) having a protease domain. Affinity enhancement procedures, sometimes referred to as “panning”, typically incubate the phage, plasmid or polysome with the immobilized MTSP9 polypeptide (s) for multiple times; Collect phage, plasmid or polysome (with accompanying DNA or mRNA) that binds MTSP9 polypeptide (s); Generating a greater amount of phage or plasmid collected (along with the accompanying Lacl-peptide fusion protein).
[406] Peptides and Peptide Mimetics
[407] Peptides, polypeptides and peptide mimetics for therapeutic applications include those having a molecular weight of about 250 to about 8,000 daltons. When such peptides are oligomerized, dimerized and / or derivatized with a hydrophilic polymer (eg, to increase the affinity and / or activity of the compound in question), the molecular weight of the peptide may be substantially greater and , About 500 to about 120,000 daltons, generally about 8,000 to about 80,000 daltons. The peptide may contain 9 or more natural or synthetic (non-natural) amino acids. One skilled in the art can determine the affinity and molecular weight of peptides and peptide mimetics suitable for therapeutic and / or diagnostic purposes (Dower et al., US Pat. No. 6,121,238).
[408] The peptide can be covalently attached to one or more of a variety of hydrophilic polymers. Suitable hydrophilic polymers include polyalkylethers, polylactic acid, polyglycolic acid, polyoxyalkenes, polyvinylalcohols, polyvinylpyrrolidone, cellulose and cellulose derivatives, dextran and dextran derivatives exemplified by polyethylene glycol and polypropylene glycol. Included, but not limited to. When peptide compounds are derivatized with such polymers, their solubility and circulating half-life may hardly increase, and in some cases, may lower their binding activity. Peptide compounds can be dimerized and each of these dimeric subunits can be covalently attached to the hydrophilic polymer. Peptide compounds can be PEGylated, ie covalently attached to polyethylene glycol (PEG).
[409] 5. Methods of Making Peptides and Peptide Mimetics
[410] Peptides that bind MTSP9 polypeptides can be prepared by using conventional methods known in the art, such as standard solid phase techniques. Standard methods include exclusion solid phase synthesis, partial solid phase synthesis methods, fragment condensation, traditional solution synthesis, and even recombinant DNA techniques. Merrifield (1963) J. Am. Chem. Soc., 85: 2149, incorporated herein by reference.
[411] The "encrypted synthetic library" or "extremely large amount of immobilized polymer synthesis" systems (US Pat. Nos. 5,925,525 and 5,902,723) can be used to determine the minimum size of a peptide with the activity of interest. It is also possible to prepare all peptides that form peptide groups that differ from the desired motif (or the minimum size of such motif) at one, two or more residues. Such peptide aggregates can then be screened for their ability to bind to the protease domain of a target molecule, such as an MTSP9 polypeptide or generally an MTSP9 polypeptide. The immobilized polymer synthesis system or other peptide synthesis methods can also be used to synthesize cleavage homologues and deletion homologues of the peptide compounds, and combinations of cleavage and deletion homologs thereof.
[412] These procedures can also be used to synthesize peptides in which amino acids other than twenty natural amino acids, genetically encoded amino acids, are substituted at one, two or more positions of the peptide. For example, tryptophan may be substituted with naphthylalanine to facilitate synthesis. Other synthetic amino acids that may be substituted into the peptide include L-hydroxypropyl, L-3,4-dihydroxy-phenylalanyl, d-amino acids such as Ld-hydroxylsil and Dd-methylalanyl , L-α-methylalanyl, β-amino acids, and isoquinolyl. D amino acids and non-naturally occurring synthetic amino acids can also be incorporated into peptides. See Roberts et al. (1983) Unusual Amino / Acids in Peptide Synthesis, 5 (6): 341-449.
[413] Peptides also include phosphorylation [W. Bannwarth et al. (1996) Biorganic and Medicinal Chemistry Letters, 6 (17): 2141-2146], and other methods of preparing peptide derivatives (Hruby et al. (1990) Biochem. J., 268 (2): 249-262. Thus, peptide compounds may also serve as a reference for preparing peptide mimetics that exhibit similar or improved biological activity.
[414] Those skilled in the art can use various techniques to construct peptide mimetics that have the desired biological activity, which is the same or similar to the corresponding peptide compound, but which exhibits more desirable activity than the peptide in terms of solubility, stability and hydrolysis sensitivity and proteolysis. It is recognized by Morgan et al. (1989) An. Rep. Med. Chem., 24: 243-252. Methods of preparing modified peptide mimetics in N-terminal amino groups or C-terminal carboxyl groups, and / or changing one or more amide linkages in a peptide to non-amide linkages are known to those skilled in the art.
[415] Amino terminal modifications include, but are not limited to, alkylation, acetylation, and carbobenzoyl group addition, succinimide group formation methods. Murray et al. (1995) Burger's Medicinal Chemistry and Drug Discovery, 5th ed., Vol. 1, Manfred E. Wolf, ed., John Wiley and Sons, Inc.]. C-terminal modifications include modifications that form C-terminal carboxyl groups with esters, mimetics, or cyclic peptides.
[416] In addition to N-terminal and C-terminal modifications, peptide compounds, including peptide mimetics, may be advantageously modified or covalently coupled with one or more of various hydrophilic polymers. When the peptide compound is derivatized with a hydrophilic polymer, its solubility and circulatory half-life can be increased and its immunogenicity hardly concealed, and in some cases it has been found that its binding activity is lowered. Suitable non-proteinaceous polymers include polyalkylethers, polylactic acid, polyglycolic acid, polyoxyalkenes, polyvinylalcohols, polyvinylpyrrolidone, cellulose and cellulose derivatives, dextran and dex, illustrated as polyethylene glycol and polypropylene glycol. Tran derivatives include, but are not limited to. Generally, such hydrophilic polymers have an average molecular weight of about 500 to about 100,000 Daltons, including about 2,000 to about 40,000 Daltons, and about 5,000 to about 20,000 Daltons. Hydrophilic polymers may also have an average molecular weight of about 5,000 Daltons, 10,000 Daltons and 20,000 Daltons.
[417] Methods of derivatizing peptide compounds, or coupling peptides to such polymers, have been reported in Zallipsky (1995) Bioconjugate Chem., 6: 150-165; Monfardini et al. (1995) Bioconjugate Chem., 6: 62-69; US Patent No. 4,640,835; U.S. Patent 4,496,689; US Patent No. 4,301,144; US Patent No. 4,670,417; US Patent No. 4,791,192; U.S. Patent Nos. 4,179,337 and WO 95/34326, all of which are incorporated herein by reference in their entirety.
[418] Other methods of preparing peptide derivatives are described, for example, in Hruby et al. (1990), Biochem J., 268 (2): 249-262. Thus, peptide compounds serve as structural models for non-peptidic compounds with similar biological activity. One of ordinary skill in the art recognizes that various techniques can be used to construct compounds that have the desired biological activity, which is the same or similar to a particular peptide compound, but which exhibits more desirable activities in terms of solubility, stability and hydrolysis sensitivity and proteolysis [ See Morgan et al. (1989) An. Rep. Med. Chem., 24: 243-252, which is incorporated herein by reference. These techniques include those in which the peptide backbone is replaced with a backbone consisting of phosphonates, amidates, carbamates, sulfonamides, secondary amines and N-methylamino acids.
[419] Peptide compounds may exist in closed ring form with intramolecular disulfide bonds between thiol groups of cysteine. On the other hand, intermolecular disulfide bonds between thiol groups of cysteine can be produced to produce dimeric (or higher order oligomeric) compounds. One or more cysteine residues may be substituted with homocysteine.
[420] I. Conjugate
[421] a) the single stranded protease domain (or proteolytically active portion thereof) of the MTSP9 polypeptide, or its full length simogen, activated form, or double stranded or single stranded protease domain; And b) friendly separation or purification of the conjugate, directly or via a linker, to the MTSP9 polypeptide; ii) attachment of the conjugate to a particular surface; iii) promotion of detection of the conjugate; Or iv) a conjugate containing a targeting agent that promotes targeted delivery to a selected tissue or cell. Such conjugates can be chemical conjugates or fusion protein mixtures thereof.
[422] The targeting agent may be a protein or protein fragment, eg, tissue specific or tumor specific monoclonal antibody or growth factor or fragment thereof, linked directly or via a linker to the MTSP9 polypeptide or protease domain thereof. The targeting agent may also be a protein or peptide fragment containing a protein binding sequence, a nucleic acid binding sequence, a lipid binding sequence, a polysaccharide binding sequence, or a metal binding sequence, or a linker for attachment to a solid support. In certain embodiments, the conjugates comprise a) an MTSP9 polypeptide or portion thereof, as described herein; And b) a targeting agent linked directly to or via a linker to such MTSP9 polypeptide.
[423] With a MTSP9 polypeptide, for example, with a single (or multiple) protein or peptide fragment that functions to facilitate the isolation or purification of the MTSP9 polypeptide domain, the attachment of the MTSP9 polypeptide to a specific surface, or the detection of the MTSP9 polypeptide domain. Conjugates are provided, such as fusion proteins and chemical conjugates. Such conjugates can be prepared via chemical conjugation, eg thiol bonds, and by recombinant means as fusion proteins. In fusion proteins, the peptide or fragment thereof is linked to the N-terminus or C-terminus of the MTSP9 polypeptide domain. In chemical conjugates, the peptide or fragment thereof can be linked anywhere where conjugation can be performed, and multiple such peptides or peptides thereof can be linked to a single or multiple MTSP9 polypeptide domains.
[424] Targeting agents are for in vitro or in vivo delivery to specific cells or tissues, including agents that bind residues expressed on specific cells, such as cells or tissue-specific antibodies, growth factors and other factors. ; And other cell or tissue specific agents that promote direct delivery of linked proteins. Such targeting agents may be those that specifically deliver MTSP9 polypeptide into selected cells by interaction with cell surface proteins and internalization of the conjugate or MTSP9 polypeptide portion thereof.
[425] These conjugates are used in a variety of methods and in particular for use in methods that activate prodrugs whose proteins are cytotoxic upon cleavage by prodrugs, eg, specific MTSP9 located at or near the targeted cell or tissue. Suitable. Such prodrugs are administered before, concurrently or after administration of the conjugate. Upon delivery to the targeted cell, the protease activates the prodrug to produce a therapeutic effect (eg, a cytotoxic effect).
[426] 1. Junction
[427] Conjugates with linked MTSP9 polypeptides can be prepared by chemical conjugation, recombinant DNA techniques, or a combination of recombinant expression and chemical conjugation. The MTSP9 polypeptide domain and the targeting agent may be linked in any orientation, and one or more targeting agents and / or MTSP9 polypeptide domains may be present in the conjugate.
[428] a. Fusion protein
[429] Fusion proteins are provided herein. Fusion proteins may comprise a) one or multiple MTSP9 polypeptide domains; And b) a targeting agent. Fusion proteins are generally produced by recombinant expression of nucleic acids encoding such fusion proteins.
[430] b. Chemical bonding
[431] To perform chemical conjugation herein, the MTSP9 polypeptide domain is linked to the targeting agent through one or more selected linkers or directly. If the targeting agent is other than a peptide or protein, such as a nucleic acid or a non-peptide drug, chemical conjugation should be used. Any means known to those skilled in the art can be used to chemically conjugate selected moieties.
[432] 2. Linker
[433] Two purpose linkers are provided herein. The conjugate may comprise one or more linkers between the MTSP9 polypeptide moiety and the targeting agent. Additionally, the linker may be used to immobilize the MTSP9 polypeptide or portion thereof on a solid support, such as a microtiter plate, silicon or silicon-coated chip, glass or plastic support, such as for high throughput solid phase screening protocols. It is used to promote or enhance it.
[434] Any linker known to those skilled in the art to prepare conjugates can be used herein. These linkers are typically used to prepare chemical conjugates; Peptide linkers may be incorporated into the fusion protein.
[435] The linker may be any residue suitable for associating the targeting agent with the MTSP9 polypeptide. Such linkers and linkages typically include amino acid and peptide bonds, peptidic bonds, containing from 1 to about 60 amino acids, more typically from about 10 to 30 amino acids; Chemical linkers include, but are not limited to, hetero-bifunctional cleavable cross-linkers, such chemical linkers include N-succinimidyl (4-iodoacetyl) -aminobenzoate, sulfosuccinimi Dyl (4-iodoacetyl) -aminobenzoate, 4-succinimidyl-oxycarbonyl-a- (2-pyridyldithio) toluene, sulfosuccinimidyl-6- [a-methyl-a- (Pyridyldithiol) -toluamido] hexanoate, N-succinimidyl-3- (2-pyridyldithio) -propionate, succinimidyl 6 [3- (2-pyridyldithio ) -Propionamido] hexanoate, 3- (2-pyridyldithio) -propionyl hydrazide, Elman reagent, dichlorotriazine acid, and S- (2-thiopyridyl) -L-cysteine However, it is not limited thereto. Other linkers include peptides and other residues that reduce steric hindrance between the MTSP9 polypeptide domain and the targeting agent; Intracellular enzyme substrates; Linkers that increase the flexibility of the conjugates, linkers that increase the solubility of the conjugates, linkers that increase the serum stability of the conjugates, light cleavable linkers, and acid cleavable linkers are included.
[436] Other examples of linkers and bonds suitable for chemically linked conjugates include, but are not limited to, disulfide bonds, thioether bonds, hindered disulfide bonds, and covalent bonds between free reactive groups such as amine and thiol groups. These linkages can be used to generate reactive thiol groups on one or both of the polypeptides using hetero-bifunctional reagents, and then react the thiol groups on one polypeptide with reactive thiol groups or amide groups to react reactive maleimide groups or Prepared by allowing thiol groups to be attached to others. Other linkers include acid cleavable linkers that can be cleaved in more acidic intracellular compartments such as bismaleimideethoxy propane, acid labile-transferrin conjugates and adipic acid dihydrazide; Cross linkers that are cleaved upon exposure to ultraviolet or visible light; And linkers from constant regions of human IgG ₁ , eg, variable regions (eg, C _H 1, C _H 2 and C _H 3). Batra et al. Molecular Immunol., 30: 379-386 (1993). In some embodiments, several linkers may be included to take advantage of the desired properties of each linker.
[437] Chemical linkers and peptide linkers can be inserted by covalently coupling these linkers with MTSP9 polypeptide domains and targeting agents. Such covalent coupling can be carried out using the hetero-bifunctional agents described below. Peptide linkers may also be linked by expressing a linker with a therapeutic agent (TA), a linker with a targeting agent, or a DNA encoding a linker, targeting agent and therapeutic agent (TA) as a fusion protein. Also contemplated herein are flexible linkers, and linkers that increase the solubility of the conjugate, used alone or in combination with other linkers.
[438] a) acid cleavable, light cleavable and heat sensitive linkers
[439] Acid cleavable, photocleavable and heat sensitive linkers may be used, especially when they are necessary to cleave the MTSP9 polypeptide domain so that it can be more easily reacted. Acid cleavable linkers include bismaleimideethoxy propane; And adipic dihydrazide linkers. See Fattom et al. (1992) Infection & Immun. 60: 584-589] and acid labile transferrin conjugates containing enough transferrin moieties to allow entry into the intracellular transferrin circulatory pathway (Welhoer et al. (1991) J. Biol. Chem. 266: 4309-4314, but is not limited thereto.
[440] Photocleavable linkers are cleaved upon exposure to light [Goldmacher et al. (1992) Bioconj. Chem. 3: 104-107; Which is incorporated herein by reference], a linker which releases the targeting agent upon exposure to light. Photocleavable linkers that are cleaved upon exposure to light, thereby releasing the targeting agent upon exposure to light are known. See, Hazum et al. (1981) in Pept., Proc. Eur. Pept. Symp. , 16th, Brunfeldt, K (Ed), pp. 105-110, describes the use of nitrobenzyl groups as light cleavable protecting groups for cysteine; (Yen et al. (1989) Makromol. Chem 190: 69-82) include water soluble photocleavable aerials including hydroxypropylmethacrylamide copolymers, glycine copolymers, fluorescein copolymers and methylhodamine copolymers. Coalescence is described; Goldmacher et al. (1992) Bioconj. Chem. 3: 104-107 describe crosslinkers and reagents that undergo photolysis upon exposure to light near 350 ultraviolet light (350 nm); Senter et al. (1985) Photochem.Photobiol 42: 231-237 describes nitrobenzyloxycarbonyl chloride crosslinking reagents that produce photocleavable bonds. Such linkers may be specifically used to treat skin or eye diseases that may be exposed to light using fiber optics. After administration of the conjugate, exposure of the eye or skin or other body part to light may release the targeted moiety from the conjugate. Such photocleavable linkers are useful in conjunction with diagnostic protocols where it is desired to be able to quickly remove targeting agents from the body of the animal.
[441] b) other linkers for chemical bonding
[442] Other linkers include trityl linkers, especially derivatized trityl groups, which produce a conjugate class that releases therapeutic agents at various acids or alkalinities. Thus, the flexibility imparted by the ability to preselect a pH range for releasing a therapeutic agent allows linkers to be screened based on known physiological differences between tissues in need of delivery of the therapeutic agent. 5,612,474]. For example, the acidity of tumor tissue is believed to be lower than that of normal tissue.
[443] c) peptide linkers
[444] The linker moiety can be a peptide. Peptide linkers can be used for fusion proteins and chemically linked conjugates. Such peptides typically have about 2 to about 60 amino acid residues, for example about 5 to about 40, or about 10 to about 30 amino acid residues. The length chosen depends on factors such as the use for which the linker is included.
[445] Peptide linkers are advantageous when the targeting agent is proteinaceous. For example, the linker residue can be, for example, a flexible spacer amino acid sequence as known in single chain antibody studies. Examples of such known linker moieties include peptides such as (Gly _m Ser) _n and (Ser _m Gly) _n [where n is 1 to 6, including 1 to 4 and 2 to 4, m is 1 to 6, including 1 to 4 and 2 to 4], enzymatic cleavable linkers, and the like, but not limited thereto.
[446] Additional linking moieties are described, for example, in Huston et al., Proc. Natl. Acad. Sci. U.S.A. 85: 5879-5883, 1988; Whitlow, M., et al., Protein Engineering 6: 989-995, 1993; Newton et al., Biochemistry 35: 545-553,1996; A. J. Cumber et al., Bioconj. Chem. 3: 397-401, 1992; Ladurner et al., J. Mol. Biol. 273: 330-337, 1997; And US Patent 4,894,443. In some embodiments, several linkers may be included to take advantage of the desired properties of each linker.
[447] 3. Targeting agent
[448] Any agent that facilitates detection, immobilization, or purification of the conjugate is used herein. In the case of chemical conjugates, all residues having this property are considered; In the case of fusion proteins, the targeting agent is a protein, peptide or fragment thereof sufficient to exhibit targeting activity. Targeting agents contemplated include the delivery of an MTSP9 polypeptide or portion thereof to selected cells and tissues. Such agents include tumor specific monoclonal antibodies and portions thereof, growth factors such as FGF, EGF, PDGF, VEGF, cytokines (including chemokines), and other agents.
[449] 4. Nucleic Acids, Plasmids and Cells
[450] Isolated nucleic acid fragments encoding fusion proteins are provided. Nucleic acid fragments encoding the fusion protein include a) a nucleic acid encoding a protease domain of an MTSP9 polypeptide; And b) a nucleic acid encoding a protein, peptide or effective fragment thereof that facilitates i) friendly isolation or purification of the fusion protein, ii) attachment of the fusion protein to a specific surface, or iii) detection of the fusion protein. Generally, the nucleic acid is DNA.
[451] Cloning plasmids and expression vectors containing the nucleic acid fragments are also provided. Cells containing such plasmids and vectors are also provided. The cell may be any suitable host, including but not limited to bacterial cells, yeast cells, fungal cells, plant cells, insect cells and animal cells. Nucleic acids, plasmids, and cells containing such plasmids can be prepared according to methods known in the art, including those described herein.
[452] Also provided is a method of preparing the fusion protein. Exemplary methods thereof include, under conditions such that the fusion protein is expressed by the cell, growing, eg culturing, the cells containing the plasmid encoding the fusion protein to proliferate; And recovering the expressed fusion protein. Methods for expressing and recovering recombinant proteins are well known in the art (Current Protocols in Molecular Biology (1998) § 16, John Wiley & Sons, Inc.), which express and recover expressed fusion proteins. It can be used to
[453] The recovered fusion protein can be isolated or purified by methods known in the art, such as centrifugation, filtration, chromatography, electrophoresis, immunoprecipitation and other methods, or by combining them. See Current Protocols. in Molecular Biology (1998) § 10, John Wiley & Sons, Inc.]. In general, the recovered fusion protein is isolated or purified through friendly binding of a protein or peptide fragment of such fusion protein with a friendly binding moiety. As discussed in the section above on construction of fusion proteins, all friendly binding pairs can be constructed and used for isolation or purification of the fusion protein. For example, a friendly binding pair may be a protein binding sequence / protein, a DNA binding sequence / DNA sequence, an RNA binding sequence / RNA sequence, a lipid binding sequence / lipid, a polysaccharide binding sequence / polysaccharide, or a metal binding sequence / metal Can be.
[454] 5. Immobilization and Supports or Substrates to It
[455] In certain embodiments in which the targeting agent is designed for linking to a surface, the MTSP9 polypeptide may be attached to the surface of a particular support or matrix material by linkage such as ionic or covalent, non-covalent or other chemical interactions. Immobilization can be performed directly or via a linker. MTSP9 polypeptides can be immobilized on any suitable support, including, but not limited to, silicon chips, and other supports described herein and known to those skilled in the art. Multiple MTSP9 polypeptides or their protease domains can be attached to a support, for example, by placing an array of conjugates (ie, two or more patterns) on the surface of a silicon chip or other chip for use in high throughput protocols and formats. Can be formed.
[456] It is also recognized that the MTSP9 polypeptide domain can be linked directly to a surface or via a linker without linking a targeting agent thereto. Thus, the chip contains an array of MTSP9 polypeptide domains.
[457] Matrix materials or solid supports contemplated herein are generally all insoluble materials known to those skilled in the art to immobilize ligands and other molecules, which are used in many chemical synthesis and separations. Such supports are used, for example, during affinity chromatography, immobilization of biologically active substances, and chemical synthesis of biomolecules (including proteins, amino acids and other organic molecules and polymers). The preparation and use of the support is well known to those skilled in the art; Many materials and methods for their preparation are known. For example, natural support materials such as agarose and cellulose can be separated from their respective sources, can be processed according to known protocols, and synthetic materials can be prepared according to known protocols. .
[458] The support is typically a solid, porous, deformable or hard insoluble material and has any structure and geometry required, including beads, pellets, discs, capillaries, pupil fibers, needles, solid fibers, random shapes, thin films and Membranes are included, but are not limited to these. Thus, the item can be fabricated from a matrix material, or can be combined with it by incorporating particles or covering all or part of the surface.
[459] Typically, when the matrix is particulate, the particles are at least about 10-2000 μm, but may be larger or smaller depending on the selected application. The choice of the matrix depends, at least in part, on their physical and chemical properties such as solubility, functional groups, mechanical stability, surface area swelling tendency, hydrophobic or hydrophilic properties and intended use.
[460] If desired, the support matrix material can be treated to contain suitable reactive moieties. In some cases, support matrix materials can be obtained commercially which contain reactive moieties in advance. As the support matrix material contains reactive moieties, it can serve as the support matrix when the molecules are linked. Materials containing reactive surface residues such as amino silane bonds, hydroxyl bonds or carboxysilane bonds can be prepared by well-established surface chemistry techniques including silanization reactions and the like. Examples of these materials are those having surface silicon oxide residues covalently linked to gamma-amino-propylsilane, and the following other organic residues: N- [3- (triethyloxysilyl) propyl] phthalemlic acid; And bis- (2-hydroxyethyl) aminopropyltriethoxysilane. Examples of readily available materials containing amino group reactive functional groups include, but are not limited to, para-aminophenyltriethoxysilane. Further, the derivatized polystyrene, and other polymers are well known, which can be obtained easily by those skilled in the art [e.g., Tentagel ^® resins are available depending on the size of the functional group, the source (Rapp Polymer, Tubingen, Germany Commercially available); (US Pat. No. 4,908,405 and US Pat. No. 5,292,814; see also Butz et al., Peptide Res., 7: 20-23 (1994); and Kleine et al., Immunobiol., 190: 53-66 (1994) Reference].
[461] These matrix materials include all materials that can act as a support matrix for attaching molecules of interest. Such materials are known to those skilled in the art and include those used as support matrices. These materials include, but are not limited to, minerals, natural polymers and synthetic polymers, such as, for example, cellulose, cellulose derivatives, acrylic resins, glass, silica gel, polystyrene, gelatin, polyvinyl pyrrolidone, Copolymers of vinyl and acrylamide, polystyrene crosslinked with divinylbenzene and the like (Merrifield, Biochemistry, 3: 1385-1390 (1964)), polyacrylamides, latex gels, polystyrenes, dextran, polyacrylamides, rubber , Silicone, plastic, nitrocellulose, cellulose, natural sponges. Of particular interest here are highly porous glasses made by mixing borosilicates, alcohols and water (see US Pat. No. 4,244,721) and the like.
[462] Synthetic supports include, but are not limited to: acrylamide, dextran-derivative and dextran copolymers, agarose-polyacrylamide blends, other polymers and copolymers with various functional groups, methacrylate derivatives And copolymers, polystyrene and polystyrene copolymers [Merrifield, Biochemistry, 3: 1385-1390 (1964); Berg et al., In Innovation Perspect. Solid Phase Synth. Collect. Pap., Int. Symp., 1st, Epton, Roger (Ed), pp. 453-459 (1990); Berg et al., Pept., Proc. Eur. Pept. Symp., 20th, Jung, G. et al. (Eds), pp. 196-198 (1989); Berg et al., J. Am. Chem. Soc., 111: 8024-8026 (1989); Kent et al., Isr. J. Chem., 17: 243-247 (1979); Kent et al., J. Org. Chem., 43: 2845-2852 (1978); Mitchell et al., Tetrahedron Lett., 42: 3795-3798 (1976); U.S. Patent No. 4,507,230; U.S. Patent No. 4,006,117; and U.S. Patent No. 5,389,449]. Such materials include polymers and copolymers such as polyvinyl alcohol, acrylates and acrylic acids, such as polyethylene-co-acrylic acid, polyethylene-co-methacrylic acid, polyethylene-co-ethylacrylate, polyethylene-co -Methyl acrylate, polypropylene-co-acrylic acid, polypropylene-co-methyl-acrylic acid, polypropylene-co-ethylacrylate, polypropylene-co-methyl acrylate, polyethylene-co-vinyl acetate, polypropylene-co Vinyl acetate, and those containing acid anhydride groups, such as those prepared from polyethylene-co-maleic anhydride and polypropylene-co-maleic anhydride. Liposomes have also been used as solid supports for friendly purification. See, Powell et al. Biotechnol. Bioeng., 33: 173 (1989)].
[463] Numerous methods have been developed for immobilizing proteins and other biomolecules on solid or liquid supports (Mosbach, Methods in Enzymology, 44 (1976); Weetall, Immobilized Enzymes, Antigens, Antibodies, and Peptides, (1975); Kennedy et al., Solid Phase Biochemistry, Analytical and Synthetic Aspects, Scouten, ed., Pp. 253-391 (1983); see, generally, Affinity Techniques. Enzyme Purification: Part B. Methods in Enzymology, Vol. 34, ed. W. B. Jakoby, M. Wilchek, Acad. Press, N.Y. (1974); and Immobilized Biochemicals and Affinity Chromatography, Advances in Experimental Medicine and Biology, vol. 42, ed. R. Dunlap, Plenum Press, N.Y. (1974).
[464] The most commonly used methods include absorption and adsorption methods known to those skilled in the art; Or a method of covalently linking to a support, either directly or via a linker, eg, a number of disulfide bonds, thioether bonds, hindered disulfide bonds, and covalent bonds between free reactive groups such as amine and thiol groups [ See the PIERCE CATALOG, ImmunoTechnology Catalog & Handbook, 1992-1993, which describes the preparation and use of such reagents and provides a source for such reagents; Wong, Chemistry of Protein Conjugation and Cross Linking, CRC Press (1993); see also DeWitt et al., Proc. Natl. Acad. Sci. U.S.A., 90: 6909 (1993); Zuckermann et al., J. Am. Chem. Soc., 114: 10646 (1992); Kurth et al., J. Am. Chem. Soc., 116: 2661 (1994); Ellman et al., Proc. Natl. Acad. Sci. U.S.A., 91: 4708 (1994); Sucholeiki, Tetrahedron Lttrs., 35: 7307 (1994); Su-Sun Wang, J. Org. Chem., 41: 3258 (1976); Padwa et al., J. Org. Chem., 41: 3550 (1971); and Vedejs et al., J. Org. Chem., 49: 575 (1984), which describes photosensitive linkers).
[465] In order to perform the immobilization, a composition containing a protein or other biomolecule is contacted with a support material such as alumina, carbon, ion exchange resin, cellulose, glass or ceramic. Fluorocarbon polymers have been used as a support for adhering biomolecules to them by adsorption. See US Pat. No. 3,843,443; PCT International Publication WO 86/03840].
[466] J. Prognosis and Diagnosis
[467] MTSP9 polypeptide proteins, domains, homologues and derivatives thereof, and nucleic acids (and complementary sequences thereof) encoding them, and anti-MTSP9 polypeptide antibodies are particularly suitable for the neck, prostate, colon, ovary, uterus, such as lung, brain and esophagus tumors. It can be used to diagnose cervical, breast and pancreatic cancer. Such molecules can be used in assays, eg, immunoassays, to detect, prognose, diagnose or monitor, or monitor the treatment of, various diseases, diseases and disorders affecting MTSP9 polypeptide expression. For the purposes herein, it is of particular interest that MTSP9 is present in body fluids or tumor tissue.
[468] In particular, the immunoassay may comprise contacting a sample derived from a patient with an anti-MTSP9 polypeptide antibody under conditions in which specific binding can occur, and detecting or measuring all specific binding amounts by such antibody. Is performed by. Binding of these antibodies in tissue sections can be used to detect abnormal MTSP9 polypeptide localization or abnormal (eg, increased, decreased or absent) levels of MTSP9 polypeptide. In certain embodiments, antibodies to MTSP9 polypeptides can be used to assay for the presence of MTSP9 polypeptides in bodily fluid samples, such as patient tissues or serum, wherein non-low-level levels of MTSP9 polypeptides are indicative of diseased status.
[469] Immunoassays that may be used include Western blot, radioimmunoassay, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassay, immunoprecipitation assay, precipitation reaction, gel diffusion precipitation reaction, immunodiffusion assay, aggregation assay, complement- Competitive and non-competitive assay systems that use techniques such as immobilization assays, immunoradiometric assays, fluorescence immunoassays, and Protein A immunoassays are included.
[470] MTSP9 polypeptide genes and related nucleic acid sequences and subsequences (including complementary sequences) can also be used in hybridization assays. MTSP9 polypeptide nucleic acid sequences or subsequences containing about 8 or more nucleotides, generally 14 or 16 or 30 or more, generally less than 1000 or 100 or fewer consecutive nucleotides, can be used as hybridization probes. Hybridization assays can be used to detect, prognose, diagnose, or monitor diseases, disorders or disease states associated with abnormal changes in MTSP9 polypeptide expression and / or activity as described herein. In particular, the hybridization assay comprises contacting a sample containing nucleic acid with a nucleic acid probe capable of hybridizing with MTSP9 polypeptide encoding DNA or RNA under conditions where hybridization can occur, and then detecting or measuring the resulting hybridization. It is done by the method.
[471] In certain embodiments, a method of diagnosing a disease or disorder characterized by detecting abnormal levels of MTSP9 polypeptide in a subject is provided by measuring the level of functional activity or DNA, RNA or protein levels of MTSP9 polypeptide in a sample derived from such subject. It is understood that it is a disease for a subject to increase or decrease the functional activity level or DNA, RNA or protein levels of such MTSP9 polypeptide compared to the functional activity or DNA, RNA or protein levels found in similar samples without disease or disorder. Or indicates that a disorder exists.
[472] Also provided are diagnostic kits containing an anti-MTSP9 polypeptide antibody in one or more containers, and optionally a labeled binding partner for such antibody. Alternatively, the anti-MTSP9 polypeptide antibody can be labeled with a detectable marker such as chemiluminescent, enzymatic, fluorescent or radioactive moiety. Also provided are kits comprising nucleic acid probes capable of hybridizing with MTSP9 polypeptide-encoding nucleic acid in one or more containers. In certain embodiments, the kit amplifies at least a portion of the MTSP9 polypeptide-encoding nucleic acid in one or more containers [eg, polymerase chain reaction (see Innis et al., 1990, PCR Protocols, Academic Press, Inc., San). Diego, CA), using a ligase chain reaction of Qβ replica (see EP 320,308), cyclic probe reaction, or other methods known in the art under appropriate reaction conditions] Eg, each size ranges from 6-30 nucleotides). The kit may optionally further comprise a predetermined amount of purified MTSP9 polypeptide or nucleic acid for use as a standard or a control, in one container.
[473] K. Pharmaceutical Compositions and Methods of Administration
[474] 1.Components of the Composition
[475] Provided herein are pharmaceutical compositions containing compounds identified to modulate the activity of MTSP9 polypeptide. Also provided are combinations of compounds that modulate the activity of MTSP9 polypeptide and another therapeutic or therapeutic compound (eg, chemotherapeutic compound) for the treatment of neoplastic disorders.
[476] The MTSP9 polypeptide modulator and antitumor agent may be packaged together as separate compositions for administration together, sequentially or intermittently. Alternatively, they can be provided as a composition for single administration or as two compositions for administration as a single composition. These combinations can be packaged as kits.
[477] a. MTSP9 polypeptide inhibitor
[478] When used alone or in combination with other compounds, alleviates, reduces, ameliorates or prevents diagnostic symptoms or clinical symptoms associated with neoplastic diseases, including undesirable and / or uncontrollable levels of angiogenesis. MTSP9 polypeptide inhibitors, including those described herein, which can provide or maintain a remission state, can be used in the combinations of the present invention.
[479] In one embodiment, the MTSP9 polypeptide inhibitor comprises an antibody or fragment thereof that specifically reacts with the MTSP9 polypeptide or protease domain thereof; MTSP9 polypeptide production inhibitors; MTSP9 polypeptide membrane-localization inhibitors; Or any inhibitor on the expression, or especially its activity, of the MTSP9 polypeptide.
[480] b. Anti-angiogenic and anti-tumor agents
[481] When used alone or in combination with other compounds, undesirable and / or uncontrolled angiogenesis and / or tumor growth and metastasis, in particular solid neoplasms, vascular malformations and cardiovascular disorders, chronic inflammatory diseases and abnormal wound healing, What is described herein that can alleviate, reduce, ameliorate, or prevent, or provide or maintain a remission of, a diagnostic marker or clinical symptom associated with a circulatory disorder, crest symptom, skin disorder, or ocular disorder. All anti-angiogenic and anti-tumor agents, including, can be used in the combinations of the present invention. Also contemplated are antitumor agents for use in combination with inhibitors of MTSP9 polypeptide.
[482] c. Antitumor and Anti-angiogenic Agents
[483] Compounds identified or provided herein by the methods provided herein can be used in combination with anti-tumor agents and / or anti-angiogenic agents.
[484] 2. Formulations and Routes of Administration
[485] Compounds and formulations herein may typically be formulated as pharmaceutical compositions for single dose administration. The concentration of compound in such formulations is effective to deliver an amount effective for the intended treatment upon administration. Typically, the composition is formulated for single dose administration. To formulate the composition, a weight fraction of a particular compound or mixture thereof is dissolved, suspended, dispersed or dispersed in a vehicle selected at a concentration effective to allow the disease to be treated to be eliminated or alleviated. Pharmaceutical carriers or vehicles suitable for the administration of the compounds provided herein include all carriers known to those skilled in the art as being suitable for the particular mode of administration.
[486] In addition, the compounds may be formulated as the only pharmaceutically active ingredient in the composition or combined with other active ingredients. Liposomal suspensions, including tissue targeting liposomes, may also be suitable as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art. For example, liposome formulations can be prepared as described in US Pat. No. 4,522,811.
[487] The active compound is included in the pharmaceutically acceptable carrier in an amount sufficient to exert a therapeutically useful effect in the absence of undesirable side effects on the patient to be treated. A therapeutically effective concentration can be determined experimentally by testing the compound by known in vitro and in vivo systems such as the assays provided herein.
[488] The concentration of active compound in the drug composition depends on the rate of absorption, inactivation and excretion of this active compound, the physicochemical characteristics of the compound, the schedule of administration, and the amount administered, as well as other factors known to those skilled in the art.
[489] Typically, a therapeutically effective amount is contemplated. The amount administered is based on a 0.001 to 1 mg / ml order of blood dose, including about 0.005 to 0.05 mg / ml and about 0.01 mg / ml. Pharmaceutical dosage unit forms are prepared to provide from about 1 mg to about 1000 mg, generally from about 10 to about 500 mg and from about 25 to 75 mg of the essential active ingredient or combination of essential active ingredients per dosage unit form. The exact dosage can be determined experimentally.
[490] The active ingredient may be administered once or divided into a number of smaller doses administered at intervals of time. It is to be appreciated that the exact dosage and duration of administration will vary depending on the disease to be treated, which can be determined experimentally using known test protocols or by extrapolation from in vivo or in vitro test data. It should also be appreciated that concentrations and dosages may vary depending on the severity of the disease to be alleviated. For all specific subjects, a special dosage regimen should be adjusted over time depending on the needs of the individual and the professional judgment of the person administering the composition or administering the composition, and the concentration ranges presented herein are illustrative only, It should further be appreciated that the scope or use of the claimed compositions and combinations containing them is not limited.
[491] Pharmaceutically acceptable derivatives include acid, salt, ester, hydrate, solvate and prodrug forms. Derivatives are typically chosen such that their pharmacodynamic properties are superior to the corresponding neutral compounds.
[492] Thus, at least one effective concentration or effective amount of a compound provided herein or a pharmaceutically acceptable derivative thereof is mixed with a pharmaceutical carrier or vehicle suitable for systemic, topical or topical administration to form a pharmaceutical composition. The compound is included in an amount effective to ameliorate or treat the disorder to be treated. The concentration of the active compound in the composition depends on the absorption, inactivation, release rate, dosing schedule, amount administered, amount of the particular formulation, as well as other factors known to those skilled in the art.
[493] Solvents or suspensions used for parenteral, intradermal, subcutaneous or topical administration may include the following ingredients: sterile diluents, for example, water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or Other synthetic solvents; Antimicrobial agents such as benzyl alcohol and methyl parabens; Antioxidants such as ascorbic acid and sodium bisulfite; Chelating agents such as ethylenediaminetetraacetic acid (EDTA); Buffers such as acetate, citrate and phosphate; And tonicity modifiers such as sodium chloride or dextrose. Parenteral preparations may be enclosed in ampoules, disposable syringes, or vials of single or several doses made of glass, plastic or other suitable material.
[494] If the compound exhibits insufficient solubility, a method of solubilizing the compound can be used. Such methods are known to those skilled in the art, including the use of cosolvents such as dimethylsulfoxide (DMSO), the use of surfactants such as Tween ^® , or the dissolution in aqueous sodium bicarbonate. Include, but are not limited to. Derivatives of such compounds, such as prodrugs of those compounds, may also be used to formulate effective pharmaceutical compositions. For ophthalmic use, the compositions may be formulated in an ophthalmically acceptable carrier. For ophthalmic use herein, topical administration by topical or injection is contemplated. Sustained release formulations are also desirable. Typically, the composition is formulated for single administration to ensure that an effective amount is administered in one batch.
[495] Upon compounding or addition of the compound with the vehicle, the resulting mixture may be a solution, suspension, emulsion or other composition. The form of the resulting mixture depends on a number of factors, including the intended mode of administration and the solubility of the compound in the selected carrier or vehicle. If necessary, pharmaceutically acceptable salts or other derivatives of the compounds are prepared.
[496] The compound is included in a pharmaceutically acceptable carrier in an amount sufficient to exert a therapeutically useful effect without exhibiting undesirable side effects for the patient to be treated. It should be recognized that the number and extent of adverse events will depend on the subject's disease. For example, the undesirable side effects of certain toxicities that were tolerated in the treatment of life-threatening diseases may not be tolerated in the treatment of lesser diseases.
[497] The compounds may also be mixed with other active substances which do not impair the desired action or with substances which complement the desired action known to those skilled in the art. Formulations of formulations and compounds for use herein are suitable for oral, rectal, topical, inhalation, intranasal (eg sublingual), parenteral (eg subcutaneous, intramuscular, intradermal or intravenous), transdermal administration or any other route. It is included. In all cases the most suitable route depends on the type and severity of the disease being treated and on the nature of the particular active compound employed. Such formulations may be in unit dosage form containing a suitable amount of the compound or pharmaceutically acceptable derivative thereof, e.g. tablets, capsules, pills, powders, granules, sterile parenteral or suspensions, and oral solvents. Or in suspensions, and milk-in-water emulsions. Pharmaceutically therapeutically active compounds and derivatives thereof are typically formulated and administered in unit dosage forms or multiple dosage forms. Unit dosage form as used herein refers to physically discrete units, suitable for human and animal subjects, and which can be packaged individually as known in the art. Each unit dose contains a predetermined amount of therapeutically active compound sufficient to produce the desired therapeutic effect in association with the required pharmaceutical carrier, vehicle or diluent. Examples of unit dosage forms include ampoules and syringes, and individually packaged tablets or capsules. Unit dosage forms can be administered in fractions or several times thereof. Multiple dosage forms are multiple identical unit dosage forms packaged in a single container intended to be administered in separate unit dosage forms. Examples of multiple dosage forms include vials, bottles of tablets or capsules, or pint or gallon bottles. Thus, multiple dosage forms are multiple unit dosage forms that are packaged in isolation.
[498] The composition may contain the following components together with the active compound: diluents such as lactose, sucrose, dicalcium phosphate, or carboxymethylcellulose; Lubricants, magnesium stearate, calcium stearate and talc; And binders such as starch, natural gums such as acacia gum, gelatin, glucose, molasses, polyvinylpyrrolidone, cellulose and derivatives thereof, povidone, crospovidone, and other binders known to those skilled in the art. Pharmaceutically administrable liquid compositions can, for example, dissolve the active compound and any pharmaceutical adjuvant as defined above in a carrier such as water, saline, aqueous dextrose, glycerol, glycol, ethanol, and the like, It can manufacture by forming a solvent or suspension by disperse | distributing or mixing. In some cases, the pharmaceutical composition to be administered may contain trace amounts of nontoxic auxiliary substances, such as wetting agents, emulsifying or solubilizing agents, pH buffers, and the like, for example, acetates, sodium citrate, cyclodextrin derivatives, sorbitan mono Laurate, triethanolamine sodium acetate, triethanolamine oleate, and other agents. Methods of preparing such dosage forms are known or will be apparent to those skilled in the art (Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., 15th Edition, 1975). The composition or formulation to be administered contains an active compound in an amount sufficient to alleviate the symptoms of the subject to be treated.
[499] Dosage forms or compositions may be prepared which contain the active ingredient in a range of 0.005 to 100%, with the remainder consisting of a nontoxic carrier. For oral administration, the pharmaceutical compositions may contain pharmaceutically acceptable excipients such as binders (eg pregelatinized corn starch, polyvinyl pyrrolidone or hydroxypropyl methylcellulose); Fillers such as lactose, microcrystalline cellulose or calcium hydrogen phosphate; Lubricants such as magnesium stearate, talc or silica; Disintegrants such as potato starch or sodium starch glycolate; Or in the form prepared by conventional means using a humectant such as sodium lauryl sulfate, for example in the form of a tablet or capsule. Tablets may be coated by methods well known in the art.
[500] Pharmaceutical formulations may also be in liquid form, eg, in the form of a solvent, syrup or suspension, or may be presented as a drug product for reconstitution with water or other suitable vehicle before use. Such liquid preparations include pharmaceutically acceptable additives, for example suspending agents (eg sorbitol syrup, cellulose derivatives or hydrogenated edible fats); Emulsifiers such as lecithin or acacia; Non-aqueous vehicles (eg almond oil, oily esters, or fractionated vegetable oils); And preservatives such as methyl or propyl p-hydroxybenzoate or sorbic acid.
[501] Formulations suitable for rectal administration may be presented as unit dose suppositories. They can be prepared by mixing the active compounds with one or more conventional solid carriers, such as cocoa butter, and then preparing the appearance of the resulting mixture.
[502] Formulations suitable for topical administration to the skin or eye are generally formulated as ointments, creams, lotions, pastes, gels, sprays, aerosols and oils. Carriers that can be used include petrolatum, lanolin, polyethylene glycols, alcohols, and combinations of two or more thereof. Topical formulations selected from hydroxypropyl methyl cellulose, methyl cellulose, polyvinylpyrrolidone, polyvinyl alcohol, poly (alkylene glycol), poly / hydroxyalkyl, (meth) acrylate or poly (meth) acrylamide It may further be advantageous to contain 0.05 to 15% by weight thickener. Topical formulations are often applied by infusion or as ointments into the conjunctival sac. The eyes, facial sinuses, and ear canal may also be used for stimulation or lubrication. Injection may be in front of the eye cavity or into another location. Topical formulations in liquid form can also be presented as strips, contact lenses, and other forms of hydrophilic three-dimensional polymer matrices from which the active ingredient is released.
[503] For inhaled administration, the compounds for use herein are pressurized packs or nebulizers using suitable propellants, such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. Can be delivered in the form of an aerosol spray. In the case of a pressurized aerosol, the dosage unit can be determined by mounting a valve that allows a metered amount to be delivered. For example, gelatin cartridges and capsules may be formulated for use in an inhaler, containing a powder mixture of the compound and a suitable powder base, such as lactose or starch.
[504] Formulations suitable for intraoral (sublingual) administration include, for example, lozenges containing the active compound in a flavor base, typically sucrose and acacia or tragacand; And pastilles containing the compound in an inert base such as gelatin and glycerin or sucrose and acacia.
[505] The compounds can be formulated for injuries by injection, eg, by cyclic injection or continuous infusion. Injectable formulations may be presented in unit dosage forms, eg, in ampoules or in several containers, with preservatives added. Such compositions may be suspending agents, solvents or emulsions in oily or aqueous vehicles, and may contain formulating agents such as suspending agents, stabilizers and / or dispersing agents. Alternatively, the active ingredient may be in powder form for reconstitution with a suitable vehicle, eg, sterile pyrogen-free water or other solvents, before use.
[506] Formulations suitable for transdermal administration may be presented in discrete patch forms adapted to intimate contact with the epidermis of the recipient for long periods of time. Such patches suitably contain the active compound as any buffered aqueous solution at a concentration of 0.1 to 0.2 M relative to this active compound. Formulations suitable for transdermal administration can be delivered by iontophoresis (Pharmaceutical Research 3 (6), 318 (1986)), which typically can take the form of any buffered aqueous solution of the active compound.
[507] Pharmaceutical compositions can also be administered by sustained release means and / or delivery devices. See, eg, US Pat. Nos. 3,536,809; 3,598,123; 3,630,200; 3,845,770; 3,847,770; 3,916,899; 4,008,719; 4,687,610; 4,769,027; 5,059,595; 5,073,543; 5,120,548; 5,354,566; 5,591,767; 5,639,476; 5,674,533 and 5,733,566.
[508] Desired blood levels can be maintained by continuous infusion of an active agent as identified as plasma levels. The attending physician should be aware of the timing and methods of adjusting, terminating or discontinuing the treatment with lesser doses due to toxicity or bone marrow, liver or kidney dysfunction. Conversely, the attending physician would know when and how to administer higher levels if the clinical response is not appropriate (precludes toxic side effects).
[509] The efficacy and / or toxicity of MTSP9 polypeptide inhibitor (s), used alone or in combination with other agents, can be assessed by methods known in the art. See O'Reilly, Investigational New Drugs, 15: 5. -13 (1997).
[510] The active compound or pharmaceutically acceptable derivative can be prepared with a carrier such as a sustained release formulation or coating which prevents such compound from being rapidly removed from the body.
[511] Kits are provided containing the composition and / or combinations with instructions for its administration. Such kits may further comprise a sterile packaged needle or syringe, and / or a packaged alcohol pad, typically for injecting the complex. Instructions are optionally included to enable the clinician or patient to administer the active agent.
[512] Finally, a composition comprising a compound or MTSP9 polypeptide or a protease domain thereof, or any of the agents described above, comprises a packaging material; In such packaging materials, a compound provided herein or a suitable derivative thereof, effective for treating a disease or disorder contemplated herein; And the compound or a suitable derivative thereof, may be packaged as a product containing a label indicating that the compound or suitable derivative thereof is to be used for treating a disease or disorder contemplated herein. Such labels optionally describe the disorder to be treated.
[513] L. Methods of Treatment
[514] Compounds identified by the methods herein are used to treat or prevent neoplastic diseases in animals, particularly mammals (including humans). In one embodiment, such methods include treating or preventing a disease or disorder by administering to a mammal an effective amount of a MTSP9 polypeptide inhibitor.
[515] In one embodiment, the MTSP9 polypeptide inhibitor used in the treatment or prophylaxis is administered with a pharmaceutically acceptable carrier or excipient. The treated mammal may be a human. Inhibitors provided herein have been identified by screening assays. Also contemplated are antibodies and antisense nucleic acids or double stranded RNA (dsRNA), such as RNAi.
[516] The method of treatment or prophylaxis may comprise an anti-angiogenic treatment or agent or anti-tumor agent which may be any compound identified as inhibiting the activity of the MTSP9 polypeptide concurrently with or prior to or after administration of the MTSP9 polypeptide inhibitor. It may further comprise administering. Such compounds include small molecule modulators; An antibody or fragment or derivative thereof containing a binding region thereof for MTSP9 polypeptide; Antisense nucleic acids or double-stranded RNA (dsRNA) encoding a portion of the MTSP9 polypeptide or its complementary portion, eg, RNAi; And a nucleic acid containing at least a portion of a gene encoding a MTSP9 polypeptide into which the heterologous nucleotide sequence is inserted such that the heterologous sequence inactivates the biological activity of at least a portion of the gene encoding the MTSP9 polypeptide, wherein the gene encoding the MTSP9 polypeptide Flanking the heterologous sequence enhances homologous recombination with genomic genes encoding the MTSP9 polypeptide. In addition, the molecule is generally less than about 1000 nt in length.
[517] 1. Antisense Treatment
[518] In certain embodiments, as mentioned above, MTSP9 polypeptide function is lowered or inhibited by MTSP9 polypeptide antisense nucleic acids to treat or prevent neoplastic disease. Nucleic acids of at least 6 nucleotides, typically up to about 150 nucleotides, which are antisense to the gene or cDNA encoding the MTSP9 polypeptide or portion thereof are used therapeutically or prophylactically. MTSP9 polypeptide “antisense” as used herein refers to a nucleic acid that, through some sequence complementarity, can hybridize with a portion of MTSP9 polypeptide RNA (generally mRNA), generally under high stringent conditions. Such antisense nucleic acids may be complementary to the coding and / or non-coding regions of MTSP9 polypeptide mRNA. The antisense nucleic acid is useful as a therapeutic agent for lowering or inhibiting MTSP9 polypeptide function and can be used to treat or prevent the disorders mentioned above.
[519] MTSP9 polypeptide antisense nucleic acids are six or more nucleotides and are generally oligonucleotides (range of 6 to about 150 nucleotides, including 6 to 50 nucleotides). The antisense molecule may be complementary to all or part of the protease domain. For example, oligonucleotides are at least 10 nucleotides, at least 15 nucleotides, at least 100 nucleotides or at least 125 nucleotides. Oligonucleotides may be single-stranded or double-stranded DNA or RNA, or chimeric mixtures or derivatives or modifications thereof. Oligonucleotides may be modified at base residues, sugar residues or phosphate backbones. Oligonucleotides are agents that facilitate transport into other attached groups, such as peptides or cell membranes. Letsinger et al., Proc. Natl. Acad. Sci. U.S. A. 86: 6553-6556 (1989); Lemaitre et al., Proc. Natl. Acad. Sci. U.S.A. 84: 648-652 (1987); PCT Publication No. WO 88/09810, published December 15, 1988) or agents that facilitate transport into the blood-brain barrier (see PCT Publication No. WO 89/10134, published April 25, 1988), hybridization-triggered cleavage preparations (Krol et al., BioTechniques 6: 958-976 (1988)) or inserts (Zon, Pharm. Res. 5: 539-549 (1988).
[520] MTSP9 polypeptide antisense nucleic acids are generally oligonucleotides, typically single-stranded DNA or RNA or homologues or mixtures thereof. For example, oligonucleotides include sequences that are antisense to a portion of the nucleic acid encoding a human MTSP9 polypeptide. Oligonucleotides can be modified at any position on their structure, generally using substituents known in the art.
[521] MTSP9 polypeptide antisense oligonucleotides include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylquieocin, inosine, N6-isopentenyladenine, 1-methylguanine, 1 -Methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-meth Methoxyaminomethyl-2-thiouracil, beta-D-mannosylquieocin, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5- Oxyacetic acid (v), wibutoxincin, pseudouracil, quiocin, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thioou Sil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl ) Uracil, (acp3) w and 2,6-diaminopurine, but may include one or more modified base residues selected from the group consisting of, but not limited to.
[522] In another embodiment, the oligonucleotide comprises one or more modified sugar residues selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylose and hexose. Oligonucleotides include phosphorothioates, phosphorodithioates, phosphoramidothioates, phosphoramidates, phosphoramidates, methylphosphonates, alkyl phosphoesters and formacetals, or analogs thereof And one or more modified sugar residues selected from the group including, but not limited to.
[523] Oligonucleotides may be α-anomeric oligonucleotides. α-amorphous oligonucleotides form specific double-stranded hybrids with complementary RNA, which chains are performed side by side with each other (see Gautier et al., Nucl. Acids Res. 15: 6625-6641 (1987).
[524] Oligonucleotides can be conjugated with other molecules such as, but not limited to, peptides, hybridization triggered crosslinkers, transporters and hybridization triggered cleavage agents. Oligonucleotides can be synthesized by using standard methods known in the art, such as automated DNA synthesizers (eg, available from Biosearch, Applied Biosystems, etc.). By way of example, phosphorothioate oligonucleotides are described in Stein et al. Nucl. Acids Res. 16: 3209 (1988)], and methylphosphonate oligonucleotides can be prepared by using a controlled porous glass polymer support (Sarin et al., Proc. Natl. Acad. Sci. U.S.A. 85: 7448-7451 (1988).
[525] In certain embodiments, the MTSP9 polypeptide antisense oligonucleotide comprises a catalytic RNA or ribozyme. PCT International Publication WO 90/11364, published October 4, 1990; Sarver et al., Science 247: 1222-1225 (1990). In another embodiment, the oligonucleotide is 2'-0-methylribonucleotide [Inoue et al., Nucl. Acids Res. 15: 6131-6148 (1987)], or chimeric RNA-DNA homologs (Inoue et al., FEBS Lett. 215: 327-330 (1987). Alternatively, the oligonucleotide may be double stranded RNA (dsRNA), for example RNAi.
[526] In another embodiment, the MTSP9 polypeptide antisense nucleic acid is produced intracellularly by transcription from an exogenous sequence. For example, vectors are introduced in vivo such that these vectors or portions thereof are taken up by the transcribed cells to produce antisense nucleic acids (RNAs). Such vectors will contain sequences encoding MTSP9 polypeptide antisense nucleic acids. The vector can be integrated into the chromosome or maintained episomally so long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA techniques that are standard in the art. Vectors can be plasmids, viral or other vectors known in the art, used to replicate and express in mammalian cells. Expression of the sequence encoding the MTSP9 polypeptide antisense RNA can be performed by any promoter known in the art to act in mammalian cells, including humans. Such promoters may be inducible or constitutive. Such promoters include, but are not limited to: SV40 early promoter region (Bernoist and Chambon, Nature 290: 304-310 (1981)), promoters contained in the 3 'long terminal repeat of the Raus sarcoma virus [ Yamamoto et al., Cell 22: 787-797 (1980)], herpes thymidine kinase promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78: 1441-1445 (1981), the regulatory sequence of the metallothionein gene (Brinster et al., Nature 296: 39-42 (1982)) and the like.
[527] The antisense nucleic acid comprises a sequence complementary to at least a portion of an RNA transcript of a MTSP9 polypeptide gene, including a human MTSP9 polypeptide gene. Absolute complementarity is not required.
[528] The amount of MTSP9 polypeptide antisense nucleic acid effective for the treatment or prevention of neoplastic diseases depends on the type of disease, which can be determined experimentally by standard clinical techniques. Where possible, antisense cytotoxicity in cells is determined in vitro, then determined in a useful animal model system, and then tested and used in humans.
[529] 2. RNA interference
[530] RNA interference (RNAi) [Chuang et al. (2000) Proc. Natl. Acad. Sci. U.S.A. 97: 4985 can be used to inhibit expression of genes encoding MTSP9. Interfering RNA (RNAi) fragments, particularly double stranded (ds) RNAi, can be used to lose MTSP9 function. Mammal, seed. Organisms, including C. elegans, Drosophila and plants, and methods related to the use of RNAi in humans are known. Fire et al. (1998) Nature 391: 806-811 Fire (1999) Trends Genet. 15: 358-363; Sharp (2001) Genes Dev. 15: 485-490; Hammond, et al. (2001) Nature Rev. Genet. 2: 110-1119; Tuschl (2001) Chem. Biochem. 2: 239-245; Hamilton et al. (1999) Science 286: 950-952; Hammond et al. (2000) Nature 404: 293-296; Zamore et al. (2000) Cell 101: 25-33; Bernstein et al. (2001) Nature 409: 363-366; Elbashir et al. (2001) Genes Dev. 15: 188-200; Elbashir et al. (2001) Nature 411: 494-498; International PCT application No. WO 01/29058; International PCT application No. WO 99/32619).
[531] Double-stranded RNA (dsRNA) -expressing constructs are introduced into a host, eg, an animal or plant, using a replication vector that is maintained as episomal or integrated into the genome. By selecting the appropriate sequence, expression of dsRNA can interfere with the accumulation of endogenous mRNA encoding MTSP9. RNAi can also be used to inhibit expression in vitro. RNAi is prepared using a region comprising about 21 or more (or 21) nucleotides that are selective (ie unique) for MTSP9. Fragments smaller than about 21 nucleotides can be transformed directly into cells (in vitro or in vivo), and larger RNAi dsRNA molecules are introduced using a vector encoding them. The dsRNA molecule is at least about 21 bp in length, for example 50, 100, 150, 200 or more. Methods, reagents and protocols for introducing nucleic acid molecules into cells in vitro and in vivo are known to those skilled in the art.
[532] 3. Gene Therapy
[533] In an exemplary embodiment, the nucleic acid comprising a nucleotide sequence encoding a MTSP9 polypeptide or functional domain or derivative thereof is administered to enhance MTSP9 polypeptide function by gene therapy. Gene therapy refers to therapies performed by administering nucleic acids to a subject. In this embodiment, the nucleic acid produces its encoded protein, which mediates a therapeutic effect by enhancing MTSP9 polypeptide function. Any method for gene therapy available in the art can be used. See Goldspiel et al., Clinical Pharmacy 12: 488-505 (1993); Wu and Wu, Biotherapy 3: 87-95 (1991); Tolstoshev, An. Rev. Pharmacol. Toxicol. 32: 573-596 (1993); Mulligan, Science 260: 926-932 (1993); and Morgan and Anderson, An. Rev. Biochem. 62: 191-217 (1993); TIBTECH 11 (5): 155-215 (1993). For example, one therapeutic composition for gene therapy includes an MTSP9 polypeptide-encoding nucleic acid that is part of an expression vector that expresses an MTSP9 polypeptide or domain, fragment or chimeric protein in a suitable host. In particular, the nucleic acid has a promoter operably linked to the MTSP9 polypeptide coding region, which promoter is inducible or constitutive and optionally tissue specific. In another specific embodiment, a nucleic acid molecule is used in which the MTSP9 polypeptide coding sequence and all other desired sequences are flanked by regions that promote homologous recombination at desired locations in the genome, thereby providing intrachromosomal expression of the SP protein nucleic acid [ See Koller and Smithies, Proc. Natl. Acad. Sci. USA 86: 8932-8935 (1989); Zijlstra et al., Nature 342: 435-438 (1989).
[534] Delivery of the nucleic acid to the patient may be performed directly (in which case the patient is directly exposed to the nucleic acid or nucleic acid-containing vector) or indirectly (in this case, the cells are first in vitro with the nucleic acid). And then transplanted to the patient). These two approaches are known as in vivo or ex vivo gene therapy, respectively.
[535] In certain embodiments, the nucleic acid is administered directly in vivo to express it to produce an encoded product. This is accomplished by a number of methods known in the art, for example, by constructing it as part of a suitable nucleic acid expression vector and administering it to, for example, a defective or attenuated retroviral or other viral vector [US Pat. 4,980,286 to make them cell resistant by infecting or directly injecting exposed DNA; Using microparticle bombardment (eg, gene gun; Biolistic, Dupont); Coating with lipid or cell-surface receptors or transfection agents, liposomes, microparticles or microcapsules, or by encapsulation, binding to a peptide known to be introduced into the nucleus, or a receptor mediated corrosion action [see Wu and Wu, J. Biol. Chem. 262: 4429-4432 (1987), which can be used to target cell types that specifically express the receptor, can be performed by binding to and administering the ligands performed. In another embodiment, a nucleic acid-ligand complex is formed, in which the ligand is a fusogenic viral peptide that disrupts the endosome, thereby allowing the nucleic acid to avoid lysosomal degradation. In another embodiment, the nucleic acid can be targeted in vivo for cell specific uptake and expression by targeting specific receptors. PCT Publications WO 92/06180 dated April 16, 1992 (Wu et al.) ; WO 92/22635 dated December 23, 1992 (Wilson et al.); WO 92/20316 dated November 26, 1992 (Findeis et al.); WO 93/14188 dated July 22, 1993 (Clarke et al.), WO 93/20221 dated October 14, 1993 (Young). Alternatively, nucleic acids can be introduced and incorporated intracellularly into host cell DNA for expression by homologous recombination. Koller and Smithies, Proc. Natl. Acad. Sci. USA 86: 8932-8935 (1989); Zijlstra et al., Nature 342: 435-438 (1989).
[536] In certain embodiments, viral vectors containing MTSP9 polypeptide nucleic acids are used. For example, retroviral vectors can be used. Miller et al., Meth. Enzymol. 217: 581-599 (1993). These retroviral vectors have been modified to delete retroviral sequences that are not necessary for the packaging of viral genes and their integration into host cell DNA. The MTSP9 polypeptide nucleic acid to be used for gene therapy is cloned into a vector to facilitate delivery of the gene to the patient. A more detailed description of retroviral vectors can be found in Boesen et al., Biotherapy 6: 291-302 (1994). This document describes the use of retroviral vectors to deliver mdr1 genes to hematopoietic stem cells to make stem cells more resistant to chemotherapy. Other references that exemplify the use of retroviral vectors in gene therapy are: Clowes et al., J. Clin. Invest. 93: 644-651 (1994); Kiem et al., Blood 83: 1467-1473 (1994); Salmonsand Gunzberg, Human Gene Therapy 4: 129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3: 110-114 (1993).
[537] Adenoviruses are other viral vectors that can be used for gene therapy. Adenoviruses are vehicles of particular interest for delivering genes to the respiratory epithelium. Adenoviruses inherently infect the respiratory epithelium, causing mild disease. Other targets for adenovirus-utilized delivery systems are liver, central nervous system, endothelial cells and muscle. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3: 499-503 (1993) discusses adenovirus-utilized gene therapy. Bout et al., Human Gene Therapy 5: 3-10 (1994) describe the use of adenovirus vectors to transfer genes to the respiratory epithelium of rhesus monkeys. Other examples of the use of adenoviruses in gene therapy are given below. Rosenfeld et al., Science 252: 431-434 (1991); Rosenfeld et al., Cell 68: 143-155 (1992); and Mastrangeli et al., J. Clin. Invest. 91: 225-234 (1993).
[538] Adeno-associated virus (AAV) has also been proposed for use in gene therapy. See Walsh et al., Proc. Soc. Exp. Biol. Med. 204: 289-300 (1993).
[539] Another approach to gene therapy involves transferring genes to cells in tissue culture by methods such as electroporation, lipofection, calcium phosphate mediated transfection or viral infection. Typically, such metastasis methods involve transferring a selectable marker to the cell. The cells are then placed under selection to isolate cells that take up and express the transferred genes. The cells are then delivered to the patient.
[540] In this embodiment, the resulting recombinant cells are administered in vivo after the nucleic acid is introduced into the cells. Such introduction can be performed by any method known in the art, including transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequence of interest, cell fusion, chromosomal mediated Gene transfer, microcell-mediated gene transfer, protoplast fusion, and the like. Numerous techniques for introducing foreign genes into cells are known in the art. See Loeffler and Behr, Meth. Enzymol. 217: 599-618 (1993); Cohen et al., Meth. Enzymol. 217: 618-644 (1993); Cline, Pharmac. Ther. 29: 69-92 (1985)], they can be used as long as the essential developmental and physiological functions of the recipient cells are not destroyed. The technique can stably transfer nucleic acids into cells so that the nucleic acids can be expressed by the cells and must be inherited and expressed by their cell progeny.
[541] The resulting recombinant cells can be delivered to the patient by various methods known in the art. In one embodiment, epithelial cells are injected subcutaneously, for example. In another embodiment, recombinant skin cells can be applied as a skin graft for a patient. Recombinant blood cells (eg, hematopoietic stem or progenitor cells) may be administered intravenously. The amount of cells used depends on the desired effect, the condition of the patient and the like, which can be determined by one skilled in the art.
[542] Cells into which nucleic acids can be introduced for gene therapy purposes include all preferred cell types available, including epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; Blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; Various stem or progenitor cells, in particular hematopoietic stem or progenitor cells, such as, but not limited to, bone marrow, umbilical cord blood, peripheral blood, fetal liver and other sources thereof.
[543] For example, the cells used for gene therapy are autologous to that patient. In embodiments where recombinant cells are used for gene therapy, MTSP9 polypeptide nucleic acid is introduced into a cell so that it can be expressed by the cell or its progeny, and then the recombinant cell is administered in vivo for therapeutic effect. In certain embodiments, stem or progenitor cells are used. All stem and / or progenitor cells that can be isolated and maintained in vitro can be used efficiently according to this embodiment. Such stem cells include hematopoietic stem cells (HSC), epithelial tissues such as skin and organ linings, stem cells of embryonic cardiac muscle cells, liver stem cells (PCT Publication WO 94/08598, dated April 28, 1994). , And neural stem cells (Stemple and Anderson, Cell 71: 973-985 (1992)).
[544] Epithelial stem cells (ESCs) or keratinocytes can be obtained from tissues such as skin and organ linings by known procedures. See Rheinwald, Meth. Cell Bio. 21A: 229 (1980). In stratified epithelial tissues such as skin, regeneration occurs by mitosis of stem cells in the embryonic layer that is closest to the basal thin layer. Stem cells in the organ lining rapidly regenerate the tissue. ESCs or keratinocytes obtained from the skin or organ lining of a patient or donor can be grown in tissue culture. See Rheinwald, Meth. Cell Bio. 21A: 229 (1980); Pittelkow and Scott, Cano Clinic Proc. 61: 771 (1986). If ESCs are provided by a donor, methods of inhibiting host-to-graft reactivity (eg, radiation, drug or antibody administration to enhance adequate immunosuppression) can also be used.
[545] With respect to hematopoietic stem cells (HSCs), any technique that provides for the isolation, proliferation, and maintenance of HSCs in vitro can be used in this embodiment. Techniques to accomplish this include (a) separating and establishing HSC cultures from bone marrow cells isolated from future hosts or donors, or (b) pre-established long-term HSCs, which may be homogeneous or heterologous. Methods of using cultures are included. Non-magnetic HSCs are generally used in methods of inhibiting the transplant immune response of future hosts / patients. In certain embodiments, human bone marrow cells can be obtained from the posterior iliac ridge by needle aspiration. Kodo et al., J. Clin. Invest. 73: 1377-1384 (1984). For example, HSCs can be made in highly enriched or practically purified form. Such reinforcement may be carried out before, during or after long term incubation and may be carried out by techniques known in the art. Long-term cultures of bone marrow cells are described, for example, in modified Dexter cell culture techniques (Dexter et al., J. Cell Physiol. 91: 335 (1977) or Witlock-Witte culture technology (Witlock and Witte, Proc. Natl.Acad. Sci. USA 79: 3608-3612 (1982), which may be established and maintained.
[546] In certain embodiments, the nucleic acid to be administered for the purpose of gene therapy includes an inducible promoter operably linked to the coding region so that expression of such nucleic acid can be controlled by controlling the presence or absence of suitable transcription inducers.
[547] 3. Prodrug
[548] A method of treating a tumor is provided. This method is practiced by administering a prodrug that releases a precursor that can be cleaved at a specific site by MTSP9 and converted to the active drug in vivo. Upon contact with cells that express MTSP9 activity, the prodrug is converted to the active drug. Since the prodrug may be an conjugate that contains an active agent linked to a substrate for targeted MTSP9, such as an anti-tumor agent, such as a cytotoxic agent, or other therapeutic agent (TA), the drug or agent is the conjugate Inactive to the cell or cannot enter the cell in the middle, but is activated upon cleavage. Prodrugs may contain, for example, oligopeptides that are proteolytically cleaved by targeted MTSP9, typically oligopeptides that are relatively short of less than about 10 amino acid peptides. Cytotoxic agents include, but are not limited to, alkylating agents, antiproliferatives, and tubulin binding agents. Others include vinca drugs, mitomycin, bleomycin and taxanes.
[549] M. Animal Model
[550] Transgenic animal models and animals are provided herein, such as rodents (including mice and rats), cattle, chickens, pigs, goats, sheep, monkeys (including gorillas), and other primates. In particular, encoding MTSP9 polypeptides Transgenic non-human animals containing heterologous nucleic acids are provided, or transgenic animals that change the expression of the polypeptide, eg, by replacing or modifying a promoter region or other regulatory region of an endogenous gene. Such animals can be produced by promoting recombination between endogenous and exogenous MTSP9 genes that can be mis-expressed or overexpressed, such as by expression under a strong promoter, through homologous or other recombination events.
[551] Transgenic animals can be generated by introducing nucleic acids into germline cells or somatic cells, such as embryonic stem cells, using any known method, including but not limited to microinjection, lipofection and other gene delivery methods. have. Typically, nucleic acids are introduced into, for example, embryonic stem cells (ES), then ES cells are injected into the bladders, these bladders are implanted into foster mothers, and then transformed animals are born. Let's do it. In general, the introduction of a heterologous nucleic acid molecule into an animal's chromosome is generated by recombination between the heterologous MTSP9-encoding nucleic acid and the endogenous nucleic acid. The heterologous nucleic acid can target specific chromosomes. In some cases, knockout animals may be produced. Such animals can be produced initially by enhancing homologous recombination between an exogenous MTSP9 polypeptide gene that is biologically inactive (typically by insertion of a heterologous sequence, eg, an antibiotic resistance gene) and an MTSP9 polypeptide gene in its chromosome. . In one embodiment, the homologous recombination transforms embryonic-derived stem (ES) cells with a vector containing an inactivated MTSP9 polypeptide gene to allow homologous recombination to occur, and then such ES cells into the vesicles. Injection and implantation of such bladders into wool, followed by the generation of chimeric animals (“knockout animals”), wherein the MTSP9 polypeptide gene has been inactivated. Capecchi, Science 244: 1288-1292 (1989) )]. Such chimeric animals can be born to produce homozygous knockout animals, which can then be used to generate additional knockout animals. Knockout animals include, but are not limited to mice, hamsters, sheep, pigs, cattle, and other non-human mammals. For example, knockout mice are generated. The animal obtained can be used as a model of a specific disease, such as a cancer exhibiting the expression of MTSP9 polypeptide. The knockout animal can be used as an animal model of the disease, for example to screen or test molecules for the ability to treat or prevent the disease or disorder.
[552] It is also possible to produce other types of transgenic animals, including overexpressing the MTSP9 polypeptide. Such animals include “knock-in” animals in which normal genes have been replaced with variants such as mutants, overexpressed forms, or other forms. For example, endogenous genes of one species, for example rodents, may be replaced with genes of another species, for example humans. In addition, animals can be produced by non-heterologous recombination into other sites of the chromosome and include animals with a majority of insertion results.
[553] After generating the first generation of transgenic animals, chimeric animals can be born to produce additional animals with overexpressed or misexpressed MTSP9 polypeptides. Such animals include, but are not limited to mice, hamsters, sheep, pigs, cattle and other non-human mammals. The animal obtained can be used as a model of a specific disease, such as a cancer that exhibits over or misexpression of MTSP9 polypeptide. The animal can be used as an animal model of the disease, for example to screen or test molecules for the ability to treat or prevent the disease or disorder. In certain embodiments, mice are produced with MTSP9 polypeptides that are overexpressed or misexpressed.
[554] The following examples are exemplary and do not limit the scope of the invention.
[555] Example 1
[556] Identification of MTSP9
[557] The protein sequence of the protease domain of Matriptase (MTSP1; Accession No. AF118224) was used to search human HTGS (High Throughput Genome Sequence) database using the tblastn algorithm. This investigation and alignment algorithm compares protein interrogative sequences against a dynamically translated nucleotide sequence database in all six reading frames (two chains). Several potential serine proteases have been identified, including those designated herein as MTSP9.
[558] The translated MTSP9 sequence is 36% identical to Matriptase. MTSP9 appears to be located on chromosome 15 (AC012571 clone). Sequence investigations deposited with GenBank showed no identical sequences deposited. Further investigations of the human EST database corresponded to short segments of the MTSP9 sequence (nucleotides 631 to nucleotide 754 of SEQ ID NO: 5, or full length nucleotides 1162-1279 of SEQ ID NO: 17) except for three nucleotide mismatches. One EST clone that is almost completely paired.
[559] Identification of Tissue Sources for Cloning of MTSP9
[560] Two gene specific oligonucleotide primers were designed using the nucleotide sequence of MTSP9 derived from the genomic sequence. The sequence of the 5 'termination primer is 5'-GGCAAGCTTCCCTTCAGTATGATAACATCCATCAG-3' (SEQ ID NO: 7), and the sequence of the 3 'termination primer is 5'-AATGAGATACCACGTATCTTTCAGATCCCTTG-3' (SEQ ID NO: 8). These primers were used to screen 8 cDNA library panels from normal human tissue (Human Multiple Tissue cDNA Panel I; Clontech, Palo Alto, CA; catalog no. K1420-1). Bands (˜700 bp) were detected in the human pancreas and subsequent sequencing revealed that the nucleotide sequence of the DNA fragment was paired with the genomic MTSP9 exon sequence.
[561] Gene Expression Profile of MTSP9 in Normal Tissue, Tumor Tissue, and Cell Line
[562] To obtain gene expression profiles of MTSP9 transcripts, blots consisting of RNA extracted from 76 different human tissues were probed using MTSP9 cDNA fragments obtained from the human pancreas (Human Multiple Tissue Expression (MTE) Array; Clontech, Palo Alto, CA; catalog no. 7775-1). This analysis suggests that MTSP9 is expressed at high levels in the esophagus and at low levels in many other tissues. MTSP9 transcripts include kidney (adult and fetus), spleen (adult and fetus), placenta, liver (adult and fetus), thymus, peripheral blood leukocytes, lung (adult and fetus), pancreas, lymph nodes, bone marrow, airways, uterus, Prostate, esophagus, testes, ovaries, and glandular organs (breast, adrenal gland, thyroid gland, pituitary gland and saliva) MTSP9 also has esophageal tumor tissue, lung carcinoma (A549 cell line), and low levels of colorectal carcinoma (SW480), lymphoma (Raji and Daudi), cervix (HeLaS3) and leukemia (HL-60, K-562 and MOLT-4). ) Is expressed in the cell line.
[563] PCR amplification of cDNA encoding full length MTSP9 protease domain
[564] To obtain cDNA fragments encoding the protease domain of MTSP9, end-to-end PCR amplification using gene-specific primers and cDNA libraries from human esophagus was used. The two primers were: 5'-CGAGTTGTTCCATTAAACGTCAACAGAATAGC-3 '(SEQ ID NO: 9) at the 5' end and 5'-GCATACAGCTTTCTTTGTTTAACTTTTATCGTG-3 '(SEQ ID NO: 10) at the 3' end. The sequences of the two primers were derived from the genomic sequence of MTSP9. The 5 'primer contained a sequence encoding the portion immediately upstream of the MTSP9 protease domain initiation (RVVPLNVNRIA; SEQ ID NO: 12). The 3 'primer corresponds to the sequence immediately after the expected stop codon. The 750 bp fragment was amplified from the human esophageal cDNA library. PCR products were isolated and purified using QIAquick gel extraction kit (Qiagen, Valencia, CA; catalog no. 28704). The MTSP9 PCR product was used to amplify cDNA fragments containing restriction sites suitable for cloning into the Peacha vector pPIC9K. The gene-specific primers used were 5'-TCT CTCGAG AAAAGAATAGCATCTGGAGTCATTGCACCCAAG-3 '(SEQ ID NO: 13) at the 5' end and 5'-ATA GCGGCCGC A TTA GATGCCTGTTTTTGAAGCAATC-3 'at the 3' end. The 5 'terminal primer contains the Xhol site (underlined) and the MTSP9 protease domain portion (KRIASGVIAPK; SEQ ID NO: 15) immediately upstream of the pichia protease cleavage site, while the 3' terminal primer is immediately downstream of the stop codon (bold) Notl site (underlined) was contained.
[565] Cloning of Full Length cDNA of MTSP9 by RACE
[566] RACE-prepared cDNA libraries were normal and tumor humans using the SMART-RACE cDNA amplification kit (Clontech; catalog no. K1811-1) and the first-choice RLM-RACE kit (Ambion, Austin, TX; catalog no. Prepared from both esophageal poly A + RNA. In the 5'-RACE reaction, an antisense gene-specific primer (5'-AATGAGATACCACGTATCTTTCAGATCCCTTG-3 'SEQ ID NO: 19) was used with a sense primer hybridizing to an adapter present at the 5' end of the cDNA. Bands (˜1.3 kbp) were amplified and identified by Southern analysis for probes consisting of the protease domain of MTSP9. The 3'-RACE reaction was performed in a similar manner except that the sense gene-specific primer used was 5'-ATGAGAAGTACCGCTCTGCAGCAAGAGAG-3 '(SEQ ID NO: 20). Bands (˜0.8 kbp) were amplified and separated from agarose gels. Two RACE products were purified using TA cloning (TOPO TA Cloning Kit; Invitrogen, Carlsbad, CA; catalog no.K4500-01). Individual subclones into E. coli vectors. After transformation, plasmid DNA was isolated, purified from representative clones, and digested with EcoRI to confirm the presence of the insert. Plasmid DNA was first sequenced with M13 forward and backward primers, followed by gene-specific primers that span the entire insert in all directions.
[567] Homologs for Serine Protease Domain of MTSP9 and Other Proteases
[568] Sequence analysis of the translated coding region of MTSP9 confirmed the presence of the transmembrane domain at the N terminus and the presence of the trypsin-like serine protease domain at the C terminus. Between these domains, there is an extension of the protein sequence (149 amino acid residues in length) containing an unknown and recognizable domain, which shares 20% homology with the same extension of the protein sequence in endoceliaase 1 do. Overall, the full-length protein sequence of MTSP9 shares 42% identity with human endoceliase 1 (DESC1; GenBank Accession No. AF064819), another type II membrane type serine protease, human airway trypsin-like serine 40% identity with protease (GenBank Accession No. NP004253). MTSP9 protease domain sequencing, a trypsin characterized by the presence of a protease active cleavage site at the initiation of the domain and the presence of triad residues (histidine, aspartate and serine) in the three highly-conserved regions of the catalytic domain. It has been suggested that it is a pseudo serine protease domain. The arrangement of protease domain sequences showed 56% identity with endoceliase 1 and 48% identity with human airway trypsin-like protease domain.
[569] Sequence analysis
[570] MTSP9 cDNA and protein sequences were analyzed using MacVector (version 6.5; Oxford Molecular Ltd., Madison, Wis.). The cDNA, encoding the protease domain of MTSP9, is 699 bp in length to decode 232-amino acid protein. The nucleotide sequence of the protease domain and the translated protein sequence of MTSP9 are as follows (SEQ ID NOs: 5,6 and 16):
[571]
[572]
[573]
[574]
[575] MTSP9 cDNA and protein sequences were analyzed using MacVector (version 6.5; Oxford Molecular Ltd., Madison, Wis.). The full length encryption clone is 1,422 bp long, containing 1,257 bp long encryption region. The translated protein sequence is 418 amino acid residues in length. The DNA encoding the protease domain of MTSP9 is 699 bp long, which decodes 232 amino acid proteins.
[576]
[577]
[578]
[579]
[580]
[581] Example 2
[582] Expression of Protease MTSP Domain
[583] Nucleic acids encoding each of MTSP9 and its protease domain can be cloned into derivatives of the Pichia pastoris vector pPIC9K (Source: Invitrogen; see SEQ ID NO: 11). Plasmid pPIC9K features include 5 'AOX1 promoter fragment at 1-948; 5 'AOX1 primer site at 855-875; Alpha-factor secretion signal (s) at 949-1218; Alpha-factor primer sites at 1152-1172; Multiple cloning site at 1192-1241; 3 'AOX1 primer site at 1327-1347; 3 'AOX1 transcription termination region at 1253-1586; HIS4 ORF at 4514-1980; Kanamycin resistance gene at 5743-4928; 3 'AOX1 fragment at 6122-6879; ColE1 origin at 7961-7288; And ampicillin resistance genes in 8966-8106. The plasmid is derived from pPIC9K by removing the XhoI site in the kanamycin resistance gene and the resulting vector is named pPIC9Kx herein.
[584] C122S mutagenesis of the protease domain of MTSP9
[585] The gene encoding the protease domain of MTSP9 was mutagenesis by PCR SOE (PCR-using splicing by redundant kidneys) to unpaired cysteine at the position 122 (chymotrypsin numbering system; Cys _{292 in} MTSP9) Replace with serine. Two overlapping gene fragments, each containing an AGT codon for serine at position 122, were PCR amplified using the following primers: For the 5 'gene fragment, TCTCTCGAGAAAAGAATAGCATCTGGAGTCATTGCACCC (SEQ ID NO: 13) and AGAGGCTTCTGGCAAACTAATCCGGCGTATGTC (SEQ ID NO: 14) ; For the 3 'gene fragment, ATTCGCGGCCGCTTAGATGCCTGTTTTTGAAGCAAT (SEQ ID NO: 21) and GACATACGCCGGATTAGTTTGCCAGAAGCCTCT (SEQ ID NO: 22) are used. The amplified gene fragment was purified on a 1% agarose gel; The mixture is then re-amplified by PCR to generate the full length coding sequence for the protease domain of MTSP9 C122S. The sequence is then cleaved with the restriction enzymes NotI and XhoI and linked into the vector pPic9KX.
[586] MTSP9 Fermentation and Initial Product Recovery Fermentation
[587] Blood expressing the C122S mutant form of MTSP9. Pastoris clone GS115 / pPIC9K: MTSP9 C122S Sac MC2 was fermented to 5 liter size. 200 ml overnight cultures (approx. 25 OD600) were used to inoculate 3.2 liters of culture medium in each of the four Bioflo containers (New Brunswick Scientific, Edison, NJ). The batch phase complex medium consists of 10 g / l yeast extract, 20 g / l peptone, 40 g / l glycerol, 5 g / l ammonium sulfate, 0.2 g / l calcium sulfate (dihydrate), 2 g / l magnesium sulfate ( Heptahydrate), 2 g / l potassium sulfate, 25 g / l sodium hexametaphosphate, and 4.35 ml / l PTM1 (6.0 g / l CuSO ₄ .5H ₂ O, 0.08 g / l NaI, 3.0 g / l) l MnSO ₄ H ₂ O, 0.2 g / L Na ₂ MoO ₄ 2H ₂ O, 0.02 g / L H ₃ BO ₃ , 0.5 g / L CoCl ₂ , 20.0 g / L ZnCl ₂ , 65.0 g / l FeSO ₄ .7H ₂ O, 0.2 g / l biotin, 5.0 ml / l H ₂ SO ₄ ). Cultures were grown to pH 5.0 and 28 ° C. on the batch. Concentrated ammonium hydroxide was used to maintain the pH of the culture. KFO 880 (KABO Chemicals, Cheyenne, WY) was used to control foam (Zhang et al. (2000) Modeling Pichia pastoris Growth on Methanol and Optimizing the Production of a Recombinant Protein, the Heavy-Chain Fragment C of Botulinum Neurotoxin, Serotype A. Biotechnology and Bioengineering Vol. 70, No 1).
[588] The fermentation batch phase lasted about 22 hours, at which time the culture consumed all of the initial glycerol in the medium. Here, a fed-batch of 50% (w / v) glycerol with substrate limitation was initiated at 18 ml / L x time. In the glycerol infusion-batch, the pH of the culture was constantly increased from 5.0 to 7.0 over a 2 hour period by the addition of concentrated ammonium hydroxide. Glycerol infusion-batch was continued for about 4.5 hours. At this time, the culture reached a density of 220-250 g / l wet cell weight.
[589] Methanol was introduced after completion of the glycerol infusion-batch. The culture was changed to methanol use by consistently reducing the rate of glycerol introduction from 18 mL / L * hour to 0 mL / L * hour over 3 hours by Zhang et al. And adding 1.5 mL of methanol per liter of culture. I was. Methanol addition, used as an online scale for the MeOH sensor (Raven Biotech, Vancouver, BC, Canada), controlled the fermentor during the injection. After using the methanol initial amount as indicated by the MeOH sensor, again 1.5 mL / L was added to the culture, and the MeOH sensor was used to adjust the methanol concentration in the bath at that level throughout the injection phase. Methanol injected into the fermentor contained 2 ml / l PTM4 (2.0 g / l CuSO ₄ .5H ₂ O, 0.08 g / l NaI, 3.0 g / l MnSO ₄ H ₂ O, 0.2 g / l Na). ₂ MoO ₄ 2H ₂ O, 0.02 g / l H ₃ BO ₃ , 0.5 g / l CoCl ₂ 6H ₂ O, 7.0 g / l ZnCl ₂ , 22.0 g / l FeSO ₄ 7H ₂ O, 0.2 g / L biotin, 1.0 mL / L H ₂ SO ₄ ) solution. The introduction phase lasted about 42.5 hours.
[590] Initial product recovery
[591] The supernatant of each fermentation was collected and collected by centrifugation, and about 0.5 using a 10 kDa ultrafiltration cartridge (A / G Technologies Corp., Needham, MA) on an SRT5 ultrafiltration system (North Carolina SRT, Cary, NC) Concentrated in liters. After draining the concentrate from the system, the system was rinsed with 50 mM volume of Hepes to the same pH 7.0 as the concentrate. The concentrate and cleaning material were combined to yield about 1 liter of final ultrafiltration product. The supernatant was finally cleared with SartoBran 300 0.45 + 0.2 μm capsule filter (Sartorius Separations Div., Edgewood, NJ).
[592] Protein Purification-MTSP9
[593] The concentrated fermentation supernatant of glycosylated MTSP9 was dialyzed at pH 7.0 against 50 mM HEPES and loaded directly onto 147 mL SP Sepharose cation exchange column (Amersham-Pharmacia Biotech) pre-equilibrated with 50 mM HEPES at pH 7.0. Protein was eluted with a linear gradient of 0-500 mM NaCl in 7 column volumes at a flow rate of 5 mL / min.
[594] The active fractions were collected and dialyzed overnight against 50 mM Na ₂ HPO ₄ at pH 5.5. Then, purified and glycosylated MTSP9 was deglycosylated by adding 0.1 ml of endoglycosidase H (ProZyme, 5 U / ml) per mg of protein. The dialyzed protein solution was then adjusted to pH 7, filtered and loaded directly onto the SP Sepharose cation exchange column and eluted as described above. The active fractions were collected and benzamidine was added at a final concentration of 10 mM. Protein purity was checked by SDS-PAGE and protein concentration was determined by the use of the OD ₂₈₀ measurement and the theoretical termination factor of 2.017 mL / (mg × OD 280).
[595] Example 3
[596] Assays to Identify Candidate Compounds that Modulate the Activity of MTSP
[597] Assays to Identify Inhibitors
[598] The ability of test compounds to act as inhibitors of catalytic activity of MTSP9 can be assessed by amidolytic assays. Inhibitor-derived inhibition of amidolytic activity by recombinant MTSP9 or a protease domain portion thereof can be determined by the IC ₅₀ value in this assay.
[599] The protease domain of MTSP9 expressed as mentioned above is assayed in Costa 96 well tissue culture plates (Corning NY) to determine inhibition by various test compounds as follows. 1X direct buffer (29.2 mM Tris, pH 8.4, 29.2 mM imidazole, 217 mM NaCl (100 μL final volume) with approximately 1-10 nM protease in the absence of inhibitor or in the presence of 100,000 nM inhibitor and seven 1: 6 dilutions ) And incubate at room temperature for 30 minutes. 400 μM substrate S 2366 (L-pyroglutamyl-L-prolyl-L-arginine-p-nitroaniline, hydrochloride; DiaPharma, Westchester, OH) was added and the reaction was carried out with a SpectraMAX Plus microplate reader (Molecular Devices, Sunnyvale). CA) and then the change under absorbance at 405 nm was monitored at 37 ° C. for 20 minutes.
[600] Identification of Temperament
[601] Specific assays for use in this assay can be identified experimentally by testing the substrate. The following substrate list is an example of what may be tested:
[602] Substrate Namerescue S 2366Fatigue Glu-Pro-Arg-pNA.HCl Spectrozyme t-PACH ₃ SO ₂ -D-HHT-Gly-Arg-pNA.AcOH N-p-tosyl-Gly-Pro-Arg-pNAN-p-tosyl-Gly-Pro-Arg-pNA Benzoyl-Val-Gly-Arg-pNABenzoyl-Val-Gly-Arg-pNA Perpachrome t-PACH ₃ SO ₂ -D-HHT-Gly-Arg-pNA S 2765N-α-Z-D-Arg-Gly-Arg-pNA.2HCl S 2444Fatigue Glu-Gly-Arg-pNA.HCl S 2288H-D-Ile-Pro-Arg-pNA.HCl Spectrozyme UKCbo-L- (γ) Glu (α-t-BuO) -Gly-Arg-pNA.2AcOH S 2302H-D-Pro-Phe-Arg-pNA.2HCl S 2266H-D-Val-Leu-Arg-pNA.2HCl S 2222Bz-Ile-Glu (g-OR) -Gly-Arg-pNA.HCl (R = H (50%) and R = CH ₃ (50%) Chromozyme PKBenzoyl-Pro-Phe-Arg-pNA S 2238H-D-Phe-Pip-Arg-pNA.2HCl S 2251H-D-Val-Leu-Lys-pNA.2HCl Spectrozyme PIH-D-Nle-HHT-Lys-pNA.2HClPyr-Arg-Thr-Lys-Arg-AMCH-Arg-Gln-Arg-Arg-AMCBoc-Gln-Gly-Arg-AMCZ-Arg-Arg-AMC Spectrozyme THEH-D-HHT-Ala-Arg-pNA.2AcOH Spectrozyme fXIIaH-D-CHT-Gly-Arg-pNA.2AcOHCVS 2081-6 (MeSO ₂ -dPhe-Pro-Arg-pNA)Pepachrome fVIIa (CH ₃ SO ₂ -D-CHA-But-Arg-pNA) pNA = para-nitranylide (chromogenic) AMC = amino methyl coumarin (fluorescent)
[603] If none of the above substrates are cleaved, the above mentioned couple assay can be used. Briefly, the ability of proteases to activate enzymes such as plasminogen and trypsinogen is tested. To carry out these assays, single chain proteases are incubated with a simogen, for example plasminogen or trypsinogen, in the presence of a known substrate, for example lys-plasminogen, for do. If this single chain activates the simogen, such activated enzymes such as plasmin and trypsin will degrade the substrate to it.
[604] MTSP9 Assay for Screening Regulators
[605] The protease domain of MTSP9 expressed in Pchia pastoris was analyzed for inhibition by various test compounds in Costa 96 well tissue culture plates (Corning NY). 1X direct buffer (29.2 mM Tris, pH 8.4, 29.2 mM imidazole, 217 mM NaCl (100 μL final volume) with approximately 1-20 nM MTSP9 in the absence of inhibitor or in the presence of 100000 nM of inhibitor and 7 1: 6 dilutions )) And incubated at room temperature for 30 minutes. 400 μM of substrate Pepachrome FVIIa (Pentapharm, Norwalk, CT) was added and the reaction monitored with a SpectraMAX Plus microplate reader (Molecular Devices, Sunnyvale CA) for 20 minutes at 37 ° C. under absorbance of 405 nM.
[606] Example 4
[607] Other black
[608] These assays have been described with reference to MTSP1, but such assays can be readily adapted for use with MTSP9.
[609] Amidolytic Assay to Determine Inhibition of Matriptase or Serine Protease Activity of MTSP1
[610] The ability of a test compound to act as an rMAP catalytic activity inhibitor is assessed by determining inhibitor-derived inhibition of amidolytic activity by MAP, as measured by IC ₅₀ values. Assay buffer is HBSA (10 mM Hepes, 150 mM sodium chloride, pH 7.4, 0.1% bovine serum albumin). All reagents were obtained from the following sources (Sigma Chemical Co .; St. Louis, MO) unless otherwise noted.
[611] (a) assay at 30 or 60 minutes (preincubated with test compounds and enzymes for 30 or 60 minutes) and (b) assay at 0 minutes (no preincubation with test compounds and enzymes at all) Two IC ₅₀ assays are performed. For IC ₅₀ assays at 30 or 60 minutes, 50 microliters diluted 50 microliters of HBSA, HBSA (or HBSA alone for uncontrolled rate measurement) (to cover a wide range of concentrations) Liter of test compound, and 50 microliters of rMAP (Corvas International) diluted in buffer, are combined in appropriate wells of a Corning microtiter plate, resulting in a final enzyme concentration of 250 pM as determined by active site filtration. After 30 or 60 minutes incubation at ambient temperature, 50 microliters of substrate S-2765 (N-a-benzyloxycarbonyl-D-arginyl-L-glycyl-L-arginine-p-nitro Initiating the assay by adding aniline dihydrochloride; DiaPharma Group, Inc .; Franklin, OH) to each well yields a final assay volume of 200 microliters and a final substrate concentration of about 100 μM (about 4 times K _m ). . Prior to addition to the assay mixture, S-2765 is reconstituted in deionized water and diluted in HBSA. For IC ₅₀ assays at 0 min, the same reagents are combined: 50 microliters of 50 microliters of diluted HBSA, HBSA (or HBSA alone for uncontrolled rate measurement) (to cover the same concentration range). Test compound, and 50 microliters of substrate S-2765. The assay is initiated by adding 50 microliters of rMAP. Final concentrations of all components were the same in both IC ₅₀ assays (assay at 30 or 60 minutes, and 0 minutes).
[612] The initial velocity of chromogenic substrate hydrolysis, was measured in both black by the change in absorbance at 405nM using a Thermo Max ^® Kinetic micro-plate reader (Molecular Devices) over a period of 5 minutes, in which use is less than 5% of the added substrate It became. The concentration of added inhibitor, which reduced the initial hydrolysis rate by 50%, was defined as the respective IC ₅₀ value in each of the two assays (assay at 30 or 60 minutes, and 0 minutes).
[613] In Vitro Enzyme Assays for Specificity Determination
[614] The ability of a compound to act as a selective inhibitor of Matriptase activity determines the concentration of the test compound (IC ₅₀ ) that inhibits the activity of Matriptase by 50%, as described in the Examples above. IC ₅₀ values for were evaluated by comparing the values determined for all or some of the following serine proteases: thrombin, recombinant tissue plasminogen activator (rt-PA), plasmin, activated protein C, chymotrypsin, Factor Xa and trypsin.
[615] The buffer used for all assays is HBSA (10 mM HEPES, pH 7.5, 150 mM sodium chloride, pH 7.4, 0.1% bovine serum albumin).
[616] Assays to determine IC ₅₀ test 50 microliters under specific concentrations (covering a wide range of concentrations) diluted in 50 microliters of HBSA, HBSA (or HBSA alone for measuring V ₀ (unsuppressed rate)). Compounds and 50 microliters of this enzyme diluted in HBSA were performed by combining in appropriate wells of a Corning microtiter plate. After 30 minutes of incubation at ambient temperature, next 50 microliters of substrate under the specified concentration is added to the well, resulting in a final total volume of 200 microliters. The initial velocity of chromogenic substrate hydrolysis, was measured by the change in absorbance at 405nM using a Thermo Max ^® Kinetic micro-plate reader over a period of 5 minutes, in which less than 5% of the added substrate was used. The concentration of inhibitor added, which reduced the initial hydrolysis rate by 50%, was defined as the IC ₅₀ value.
[617] Thrombin
[618] Enzymatic activity was determined using Pepachrome t-PA (CH ₃ SO ₂ -D-hexahydrotyrosine-glycyl-L-arginine-p-nitroaniline; Pentapharm Ltd.), a chromogenic substrate. . This substrate is reconstituted in deionized water before use. Purified human α-thrombin was obtained from the source (Enzyme Research Laboratories, Inc.). The buffer used for all assays is HBSA (10 mM HEPES, pH 7.5, 150 mM sodium chloride, pH 7.4, 0.1% bovine serum albumin).
[619] IC ₅₀ crystals combine HBSA (50 μL), α-thrombin (50 μL) (final enzyme concentration is 0.5 nM) and inhibitor (50 μL) (covering a wide range of concentrations) in appropriate wells and 30 minutes at room temperature. After incubation, the substrate pepachrome-t-PA (50 μl) (final substrate concentration is 250 μM, about 5 fold Km) is added. The initial rate of pepachrome-t-PA hydrolysis was measured by absorbance change at 405 nM using a Thermo Max ^® Kinetic microplate reader over 5 minutes, where less than 5% of the added substrate was used. The concentration of inhibitor added, which reduced the initial hydrolysis rate by 50%, was defined as the IC ₅₀ value.
[620] Factor Xa
[621] A chromogenic substrate S-2765 (N-α-benzyloxycarbonyl-D-arginyl-L-glycyl-L-arginine-p-nitroaniline dihydrochloride; source: DiaPharma Group, Inc .; Franklin, OH) Using, factor Xa catalytic activity was determined. All substrates were reconstituted in deionized water before use. The final concentration of S-2765 is 250 μM (about 5 times Km). Purified human factor X was obtained from the source (Enzyme Research Laboratories, Inc .; South Bend, IN), and factor Xa (FXa) is described in Bock, PE, Craig, PA, Olson, ST, and Singh, P. Arch. Biochem. Biophys. 273: 375-388 (1989). The enzyme was diluted into HBSA prior to the assay with a final concentration of 0.25 nM.
[622] Recombinant Tissue Plasminogen Activator (rt-PA) Assay
[623] The rt-PA catalytic activity was determined using the substrate pepachrome t-PA (CH ₃ SO ₂ -D-hexahydrotyrosine-glysil-L-arginine-p-nitroaniline; Pentapharm Ltd.). The substrate was constructed in deionized water and then diluted in HBSA prior to the assay, the final concentration of which was 500 micromoles (about 3 times Km). Human rt-PA (Activase ^® ) was obtained from the source (Genentech Inc.). This enzyme was reconstituted in deionized water and diluted in HBSA prior to the assay with a final concentration of 1.0 nM.
[624] Plasmin assay
[625] Plasmin catalytic activity was determined using chromogenic substrate S-2366 (L-pyroglutamyl-L-prolyl-L-arginine-p-nitroaniline, hydrochloride; Source: DiaPharma, Westchester, OH). The substrate was constructed in deionized water and then diluted in HBSA prior to the assay, the final concentration of which was 300 micromoles (about 2.5-fold Km). Purified human plasmin was obtained from the source (Enzyme Research Laboratories, Inc.). This enzyme was diluted in HBSA prior to the assay with a final concentration of 1.0 nM.
[626] Activated Protein C (aPC) Assay
[627] Determining aPC catalytic activity using chromogenic substrate Pepachrome PC (Delta-Carbenzyloxy-D-Lysine-L-Prolyl-L-Arginine-p-nitroaniline, dihydrochloride; Pentapharm Ltd.) It was. The substrate was constructed in deionized water and then diluted in HBSA prior to the assay, the final concentration of which was 400 micromoles (about 3 times Km). Purified human aPC was obtained from the source (Hematologic Technologies, Inc.). This enzyme was diluted in HBSA prior to the assay with a final concentration of 1.0 nM.
[628] Chymotrypsin black
[629] Chymotrypsin catalytic activity was determined using chromogenic substrate S-2586 (methoxy-succinyl-L-arginine-L-prolyl-L-tyrosyl-p-nitroanilide; DiaPharma Group). The substrate was constructed in deionized water and then diluted in HBSA prior to assay, the final concentration of which was 100 micromoles (about 9 fold Km). Purified (3X-crystallized; CDI) bovine pancreatic alpha-chymotrypsin was obtained from the Washington Biochemical Corp. This enzyme was reconstituted in deionized water and diluted in HBSA prior to the assay with a final concentration of 0.5 nM.
[630] Trypsin black
[631] Trypsin catalytic activity was determined using chromogenic substrate S-2222 (benzoyl-L-isoleucine-L-glutamic acid- [gamma-methyl ester] -L-arginine-p-nitroanilide; DiaPharma Group) . The substrates were constructed in deionized water and then diluted in HBSA prior to the assay, the final concentration of which was 250 micromoles (about 4 times Km). Purified (3X-crystallized; TRL3) bovine pancreatic trypsin was obtained from Washington Biochemical Corp. This enzyme is reconstituted in deionized water and diluted in HBSA prior to the assay, where the final concentration is 0.5 nM.
[632] Since various modifications will be apparent to those skilled in the art, the invention is limited only by the appended claims.

权利要求:
Claims (109)
[1" claim-type="Currently amended] A substantially purified single or double stranded polypeptide comprising the protease domain of type II membrane-type serine protease 9 (MTSP9), or a catalytically active portion thereof.
[2" claim-type="Currently amended] The polypeptide of claim 1 which is an activating double stranded protein.
[3" claim-type="Currently amended] The method of claim 1,
A polypeptide comprising an amino acid sequence encoded by the sequence set forth as nucleotides 31-729 in SEQ ID NO: 5 and comprising an amino acid sequence that is at least about 85% identical to the amino acid sequence set forth in SEQ ID NO: 18;
A polypeptide comprising an amino acid sequence encoded by a nucleotide sequence set forth in SEQ ID NO: 17;
A polypeptide comprising an amino acid sequence encoded by nucleotide sequence set forth as nucleotides 31-729 in SEQ ID NO: 5 or 17 and nucleotide sequence hybridized along at least 70% of its full length under high stringent conditions;
A polypeptide comprising the amino acid sequence set forth in amino acids 11-242 or SEQ ID NO: 18;
A polypeptide comprising an amino acid sequence having a sequence at least about 90% identical to the amino acid sequence set forth in SEQ ID NO: 6 or 18; And
A polypeptide selected from the group consisting of a polypeptide encoded by a nucleotide sequence that is a splice variant of the sequence set forth in SEQ ID NO: 17.
[4" claim-type="Currently amended] The polypeptide of claim 1, wherein the MTSP9 portion of the polypeptide consists essentially of the protease domain of MTSP9 or a catalytically active portion thereof.
[5" claim-type="Currently amended] The substantially purified polypeptide of claim 1, wherein MTSP9 is a human polypeptide.
[6" claim-type="Currently amended] The substantially purified polypeptide of claim 1, consisting essentially of the protease domain of MTSP9 or the catalytically active portion of the protease domain of MTSP9.
[7" claim-type="Currently amended] The substantially purified polypeptide of claim 3, consisting essentially of the protease domain of MTSP9 or the catalytically active portion of the protease domain of MTSP9.
[8" claim-type="Currently amended] The substantially purified polypeptide of claim 1, comprising the amino acid sequence set forth as amino acids 11-242 in SEQ ID NO: 6.
[9" claim-type="Currently amended] The substantially purified polypeptide of claim 1, comprising the amino acid sequence set forth in SEQ ID NO: 18. 3.
[10" claim-type="Currently amended] The substantially purified polypeptide of claim 1, wherein the protease domain comprises the amino acid sequence set forth as amino acids 11-242 of SEQ ID NO: 6.
[11" claim-type="Currently amended] The substantially purified polypeptide of claim 1, wherein the polypeptide is a protease and has a sequence at least about 80% identical to a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6 or the amino acid sequence set forth in SEQ ID NO: 18.
[12" claim-type="Currently amended] The nucleotide sequence according to claim 1 or one or more domains thereof, or a nucleotide sequence set forth in nucleotide 31-729 or SEQ ID NO: 17 according to at least 70% of its full length under high stringent conditions. A polypeptide encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising a catalytically active moiety.
[13" claim-type="Currently amended] The polypeptide of claim 12, wherein the domain is a protease domain.
[14" claim-type="Currently amended] The polypeptide of claim 1, wherein the polypeptide does not comprise the complete sequence set forth in SEQ ID NO: 18 and comprises at least amino acids 85-87 and / or 160-165 of SEQ ID NO: 18. 8.
[15" claim-type="Currently amended] The polypeptide of claim 3, wherein up to about 50% of the amino acids are muteins that are single-chain or double-stranded polypeptides having at least 10% catalytic activity replaced by another amino acid and the resulting polypeptide is not mutated.
[16" claim-type="Currently amended] The polypeptide of claim 15, wherein up to about 10% of the amino acids are replaced by another amino acid.
[17" claim-type="Currently amended] The polypeptide of claim 15, wherein the polypeptide produced is a single stranded or double stranded polypeptide and has at least 50% catalytic activity of the unmutated polypeptide.
[18" claim-type="Currently amended] The polypeptide of claim 15, wherein the free cysteine in the protease domain is replaced with another amino acid.
[19" claim-type="Currently amended] The polypeptide of claim 18, wherein the amino acid replaced is serine.
[20" claim-type="Currently amended] An isolated substantially pure polypeptide consisting essentially of the protease domain of MTSP9.
[21" claim-type="Currently amended] A nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide according to any one of claims 1 to 20.
[22" claim-type="Currently amended] The method of claim 21,
(a) the nucleotide sequences set forth in nucleotides 31-729 of SEQ ID NO: 5 or SEQ ID NO: 17;
(b) a nucleotide sequence that hybridizes with the nucleotide sequence set forth in SEQ ID NO: 5 or nucleotides 31-729 or SEQ ID NO: 17 along at least about 70% of its length or its full length under high stringent conditions;
(c) a nucleotide sequence encoding the polypeptide of SEQ ID NO: 16;
(d) a nucleotide sequence that is a splice variant of (a), (b) or (c);
(e) a nucleotide sequence encoding a protease domain or catalytically active portion thereof comprising at least about 60%, 70%, 80%, 90% or 95% identical nucleotide sequence to the sequence set forth in SEQ ID NO: 5, 15 or 17; And
(f) A nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of nucleotide sequences comprising degenerate codons of (a), (b), (c), (d) or (e).
[23" claim-type="Currently amended] An isolated nucleic acid molecule encoding a mutein according to claim 15.
[24" claim-type="Currently amended] A vector comprising a nucleic acid molecule according to claim 21.
[25" claim-type="Currently amended] The vector of claim 24 which is an expression vector.
[26" claim-type="Currently amended] The vector of claim 24 which is a eukaryotic vector.
[27" claim-type="Currently amended] The vector of claim 25, comprising a nucleotide sequence directing the secretion of all polypeptides encoded by the nucleotide sequence operably linked thereto.
[28" claim-type="Currently amended] The method of claim 24, wherein the Pichia vector or E. Vector, which is a coli vector.
[29" claim-type="Currently amended] A cell comprising a vector according to claim 24.
[30" claim-type="Currently amended] The cell of claim 29 which is a prokaryotic cell.
[31" claim-type="Currently amended] The cell of claim 29 which is a eukaryotic cell.
[32" claim-type="Currently amended] 30. The cell of claim 29 selected from bacterial cells, yeast cells, plant cells, insect cells and animal cells.
[33" claim-type="Currently amended] The cell of claim 29 which is a mammalian cell.
[34" claim-type="Currently amended] A nucleic acid molecule encoding a polypeptide according to claim 6.
[35" claim-type="Currently amended] A vector comprising a nucleic acid molecule according to claim 34.
[36" claim-type="Currently amended] A cell comprising a vector according to claim 35.
[37" claim-type="Currently amended] A recombinant non-human animal in which the endogenous gene encoding the polypeptide according to claim 1 is deleted or inactivated by homologous recombination or insertion mutagenesis of the animal or its progeny.
[38" claim-type="Currently amended] Culturing the cells according to claim 29 under conditions such that the encoded polypeptide is expressed by such cells; And
Recovering the expressed polypeptide.
A method of producing a polypeptide comprising the protease domain of a MTSP9 polypeptide.
[39" claim-type="Currently amended] The method of claim 38, wherein the polypeptide is secreted into the culture medium.
[40" claim-type="Currently amended] The method of claim 38, wherein the cells are pitchia cells.
[41" claim-type="Currently amended] The method of claim 38, wherein the polypeptide is expressed in the cytoplasm of the host cell.
[42" claim-type="Currently amended] Culturing the cell according to claim 36 under conditions such that the encoded polypeptide is expressed by said cell, and
Recovering the expressed polypeptide, wherein the polypeptide comprises a protease domain of the polypeptide.
[43" claim-type="Currently amended] Comprises at least 14 contiguous nucleotides or modified nucleotides complementary to contiguous nucleotide sequences encoding the protease domain of MTSP9 according to claim 1,
21 or more contiguous nucleotides or modified nucleotides complementary to a contiguous nucleotide sequence encoding the protease domain of MTSP9 according to any one of claims 1 to 20, or
21. Nucleotide 1162-1262 of SEQ ID NO: 18 comprising at least 30 contiguous nucleotides or modified nucleotides complementary to the contiguous nucleotide sequence encoding the protease domain of MTSP9 according to any one of claims 1 to 20. Antisense nucleic acid molecule comprising.
[44" claim-type="Currently amended] The antisense molecule of claim 43 comprising a contiguous nucleotide sequence that is the complement of nucleotides 31-729 of SEQ ID NO: 5 or the nucleotide sequence set forth in SEQ ID NO: 17.
[45" claim-type="Currently amended] A double stranded RNA (dsRNA) molecule comprising at least about 21 contiguous nucleotides or modified nucleotides from a nucleotide sequence encoding MTSP9 according to any one of claims 1-20.
[46" claim-type="Currently amended] A polyclonal or monoclonal antibody, or a binding domain thereof, that specifically binds to the single and / or double stranded forms of the protease domain of a polypeptide according to any one of claims 1 to 20. Fragments or derivatives of antibodies.
[47" claim-type="Currently amended] The antibody of claim 46, wherein the antibody inhibits the enzymatic activity of the polypeptide.
[48" claim-type="Currently amended] A polyclonal or monoclonal antibody that specifically binds to the single- and double-stranded forms of the protease domain of a polypeptide according to claim 3 and contains an antibody that inhibits the enzymatic activity of the polypeptide, or a binding domain thereof. Fragments or derivatives of the above antibodies.
[49" claim-type="Currently amended] A polyclonal or monoclonal antibody that specifically binds to the single- and double-stranded forms of the protease domain of a polypeptide according to claim 6 and contains an antibody that inhibits the enzymatic activity of the polypeptide, or a binding domain thereof. Fragments or derivatives of the above antibodies.
[50" claim-type="Currently amended] A polypeptide according to any one of claims 1 to 20, and
A conjugate comprising a targeting agent linked directly to or through a linker to the polypeptide.
[51" claim-type="Currently amended] 51. The targeting agent of claim 50, wherein the targeting agent is
Friendly separation or purification of the conjugate;
Attachment to the surface of the conjugate;
Detection of conjugates; or
Conjugates that allow for targeted delivery to selected tissues or cells.
[52" claim-type="Currently amended] A polypeptide according to claim 3; And
A conjugate comprising a targeting agent linked directly to or through a linker to the polypeptide.
[53" claim-type="Currently amended] The method of claim 52, wherein the targeting agent is
Friendly separation or purification of the conjugate;
Attachment to the surface of the conjugate;
Detection of conjugates; or
Conjugates that allow for targeted delivery to selected tissues or cells.
[54" claim-type="Currently amended] A polypeptide according to claim 6; And
A conjugate comprising a targeting agent linked directly to or through a linker to the polypeptide.
[55" claim-type="Currently amended] 55. The method of claim 54, wherein the targeting agent is
Friendly separation or purification of the conjugate;
Attachment to the surface of the conjugate;
Detection of conjugates; or
Conjugates that allow for targeted delivery to selected tissues or cells.
[56" claim-type="Currently amended] Preparations or therapeutic means for inhibiting the catalytic activity of a polypeptide according to any one of claims 1 to 20; And
A combination comprising an antitumor and anti-angiogenic treatment means and another therapeutic means or agent selected from an anti-tumor and anti-angiogenic agent.
[57" claim-type="Currently amended] The combination of claim 56, wherein the inhibitor and the anti-tumor and / or anti-angiogenic agent are formulated into a single pharmaceutical composition or each formulated into a separate pharmaceutical composition.
[58" claim-type="Currently amended] The combination of claim 56, wherein the inhibitor is selected from antibodies and antisense oligonucleotides and double stranded RNAs (dsRNAs).
[59" claim-type="Currently amended] A solid support comprising at least two polypeptides according to any one of claims 1 to 20, linked directly or via a linker.
[60" claim-type="Currently amended] 60. The support of claim 59, wherein the polypeptide comprises an array.
[61" claim-type="Currently amended] 60. The support of claim 59, wherein the polypeptide comprises a plurality of different protease domains.
[62" claim-type="Currently amended] A solid support comprising an oligonucleotide portion thereof containing two or more or 16 or more nucleotides of a nucleic acid molecule according to claim 21, directly or via a linker.
[63" claim-type="Currently amended] 63. The support of claim 62, wherein the nucleic acid molecule comprises an array.
[64" claim-type="Currently amended] 63. The support of claim 62, wherein the nucleic acid molecule comprises a plurality of molecules encoding different protease domains.
[65" claim-type="Currently amended] Contacting a polypeptide according to any one of claims 1 to 20 with a substrate which is proteolytically cleaved by said polypeptide and simultaneously or before or after adding a single or multiple test compounds;
Determining the amount of substrate cleaved in the presence of the test compound; And
A method of identifying a compound that modulates a protease activity of a polypeptide, the method comprising identifying a compound that modulates the activity of the polypeptide by selecting a compound that changes the amount of cleaved substrate compared to a control.
[66" claim-type="Currently amended] 67. The method of claim 65, wherein the test compound is a small molecule, peptide, peptide- mimetic, natural product, antibody, or fragment thereof that modulates the activity of a polypeptide.
[67" claim-type="Currently amended] 66. The method of claim 65, wherein multiple test substances are screened at the same time.
[68" claim-type="Currently amended] 66. The polypeptide of claim 65, wherein the polypeptide is essentially
(a) the nucleotide sequences set forth in nucleotides 31-729 of SEQ ID NO: 5 or SEQ ID NO: 17;
(b) a nucleotide sequence that hybridizes with the nucleotide sequence set forth in SEQ ID NO: 5 or nucleotides 31-729 or SEQ ID NO: 17 along at least about 70% of its length or its full length under high stringent conditions;
(c) a nucleotide sequence encoding the polypeptide of SEQ ID NO: 16;
(d) a nucleotide sequence that is a splice variant of (a), (b) or (c);
(e) a nucleotide sequence encoding a protease domain or a catalytically active portion thereof comprising at least about 80% or 85% nucleotide sequence identical to the sequence set forth in SEQ ID NO: 5, 15 or 17; And
(f) A method comprising a polypeptide encoded by a nucleotide sequence selected from the group consisting of nucleotide sequences comprising degenerate codons of (a), (b), (c), (d) or (e).
[69" claim-type="Currently amended] 66. The polypeptide of claim 65, wherein the polypeptide is essentially
A polypeptide comprising an amino acid sequence encoded by a nucleotide sequence set forth as nucleotides 31-729 in SEQ ID NO: 5;
A polypeptide comprising an amino acid sequence encoded by a nucleotide sequence set forth in SEQ ID NO: 17;
A polypeptide comprising an amino acid sequence encoded by a nucleotide sequence which hybridizes under high stringent conditions to nucleotide 31-729 of SEQ ID NO: 5 or to the nucleotide sequence set forth in SEQ ID NO: 17;
A polypeptide comprising an amino acid sequence set forth as amino acids 11-242 in SEQ ID NO: 16;
A polypeptide comprising an amino acid sequence of at least about 60% identical to the amino acid sequence set forth as amino acid sequence 11-242 of SEQ ID NO: 6 or amino acid sequence of SEQ ID NO: 18; And
A method comprising a polypeptide selected from the group consisting of a polypeptide encoded by a nucleotide sequence which is a splice variant of the sequence set forth in SEQ ID NO: 18.
[70" claim-type="Currently amended] The method of claim 65, wherein the change in the amount of cleaved substrate is assessed by comparing the amount of substrate cleaved in the presence of the test compound with the amount of substrate cleaved in the absence of the test compound.
[71" claim-type="Currently amended] The method of claim 67, wherein the plurality of polypeptides are linked to the solid support directly or through a linker.
[72" claim-type="Currently amended] The method of claim 71, wherein the polypeptide comprises an array.
[73" claim-type="Currently amended] Contacting the MTSP9 polypeptide according to any one of claims 1 to 20 or a proteolytically active portion thereof with a single or a plurality of test compounds under conditions which permit binding thereof to be carried out; And
a) identifying a test compound that specifically binds to the proteolytically active portion of the single-stranded and / or double-stranded form of the polypeptide, or the single-stranded and / or double-stranded form thereof, or
b) identifying a test compound that inhibits binding of a compound known to bind the proteolytically active portion of the single and / or double stranded forms of the polypeptide, or the single and / or double stranded forms thereof, wherein Known compounds are contacted with the polypeptide before, simultaneously or after contacting the test compound), and the single- and double-stranded protease domains and / or single-chain or double-stranded polypeptides of the MTSP9 polypeptide and / or A method for identifying a compound that specifically binds to a proteolytically active portion of its single-chain or double-stranded form.
[74" claim-type="Currently amended] The method of claim 73, wherein the polypeptide is linked to the solid support directly or indirectly through a linker.
[75" claim-type="Currently amended] The method of claim 73, wherein the test compound is a small molecule, peptide, peptide- mimetic, natural product, antibody, or fragment thereof.
[76" claim-type="Currently amended] 74. The method of claim 73, wherein multiple test substances are screened simultaneously.
[77" claim-type="Currently amended] The method of claim 73, wherein the plurality of polypeptides are linked to a solid support.
[78" claim-type="Currently amended] The method of claim 73, wherein the polypeptide is essentially
(a) the nucleotide sequences set forth in nucleotides 31-729 of SEQ ID NO: 5 or SEQ ID NO: 17;
(b) nucleotide sequences that hybridize to nucleotides 31-729 of SEQ ID NO: 5 or nucleotide sequences set forth in SEQ ID NO: 17 along at least about 70% of their length or full length thereof under high stringent conditions;
(c) a nucleotide sequence encoding the polypeptide of SEQ ID NO: 16;
(d) a nucleotide sequence that is a splice variant of (a), (b) or (c);
(e) a nucleotide sequence encoding a protease domain or catalytically active portion thereof that comprises a nucleotide sequence that is at least about 80% or 85% identical to the sequence set forth in SEQ ID NO: 5, 15, or 17; And
(f) A method comprising a polypeptide encoded by a nucleotide sequence comprising the degenerate codons of (a), (b), (c), (d) or (e).
[79" claim-type="Currently amended] Contacting the MTSP9 polypeptide of the simogen form according to any one of claims 1 to 20 or a proteolytically active portion thereof with a substrate of an activated form of the polypeptide;
Adding the test compound before, after or simultaneously with the addition of the substrate; And
A method for identifying an activator of the simogen form of MTSP9, comprising identifying a compound that activates a simogen by detecting cleavage of the substrate.
[80" claim-type="Currently amended] 80. The method of claim 79, wherein the substrate is a chromogenic substrate.
[81" claim-type="Currently amended] 80. The method of claim 79, wherein the substrate is L-pyroglutamyl-L-prolyl-L-arginine-p-nitroaniline hydrochloride.
[82" claim-type="Currently amended] 80. The method of claim 79, wherein the test compound is a small molecule, nucleic acid or polypeptide.
[83" claim-type="Currently amended] A method of treating or preventing a neoplastic disease in a mammal, comprising administering to the mammal an effective amount of a polypeptide inhibitor according to any one of claims 1 to 20.
[84" claim-type="Currently amended] 84. The method of claim 83, wherein the inhibitor is an antibody that specifically binds a polypeptide, or a fragment or derivative of the antibody containing a binding domain thereof, wherein the antibody is a polyclonal antibody or a monoclonal antibody.
[85" claim-type="Currently amended] 84. The polypeptide of claim 83, wherein the polypeptide is essentially
(a) the nucleotide sequences set forth in nucleotides 31-729 of SEQ ID NO: 5 or SEQ ID NO: 17;
(b) nucleotide sequences that hybridize to nucleotides 31-729 of SEQ ID NO: 5 or nucleotide sequences set forth in SEQ ID NO: 17 along at least about 70% of their length or full length thereof under high stringent conditions;
(c) a nucleotide sequence encoding the polypeptide of SEQ ID NO: 16;
(d) a nucleotide sequence that is a splice variant of (a), (b) or (c);
(e) a nucleotide sequence encoding a protease domain or a catalytically active portion thereof comprising at least about 80% or 85% nucleotide sequence identical to the sequence set forth in SEQ ID NO: 5, 15 or 17; And
(f) A method comprising a polypeptide encoded by a nucleotide sequence comprising the degenerate codons of (a), (b), (c), (d) or (e).
[86" claim-type="Currently amended] 84. The polypeptide of claim 83, wherein the polypeptide is
(a) the nucleotide sequences set forth in nucleotides 31-729 of SEQ ID NO: 5 or SEQ ID NO: 17;
(b) a nucleotide sequence which hybridizes along its length under high stringent conditions to the nucleotide sequence set forth in nucleotides 31-729 or SEQ ID NO: 17 of SEQ ID NO: 5;
(c) a nucleotide sequence encoding the polypeptide of SEQ ID NO: 16;
(d) a nucleotide sequence that is a splice variant of (a), (b) or (c); And
(e) a method comprising a polypeptide encoded by the degenerate codon of (a), (b), (c) or (d).
[87" claim-type="Currently amended] 21. Inhibits the activation cleavage of the simogen form of a MTSP9 polypeptide or a potential proteolytically active portion thereof according to any one of claims 1 to 20, or inhibits the activity of the active form of MTSP9 or a proteolytically active portion thereof. A method of inhibiting tumor initiation, growth or progression, or treating a malignant disease or precancerous disease, comprising administering an agent to inhibit.
[88" claim-type="Currently amended] 88. The method of claim 87, wherein the disease is a breast, cervical, prostate, lung, ovarian or colon disease.
[89" claim-type="Currently amended] 88. The method of claim 87, wherein the agent is an antisense oligonucleotide, double stranded RNA (dsRNA) or an antibody.
[90" claim-type="Currently amended] 88. The method of claim 87, further comprising administering an anti-tumor and anti-angiogenic treatment means or another therapeutic means or agent selected from an anti-tumor and anti-angiogenic agent.
[91" claim-type="Currently amended] 88. The polypeptide of claim 87, wherein the polypeptide is essentially
(a) the nucleotide sequences set forth in nucleotides 31-729 of SEQ ID NO: 5 or SEQ ID NO: 17;
(b) nucleotide sequences that hybridize to nucleotides 31-729 of SEQ ID NO: 5 or nucleotide sequences set forth in SEQ ID NO: 17 along at least about 70% of their length or full length thereof under high stringent conditions;
(c) a nucleotide sequence encoding the polypeptide of SEQ ID NO: 16;
(d) a nucleotide sequence that is a splice variant of (a), (b) or (c);
(e) a nucleotide sequence encoding a protease domain or catalytically active portion thereof that comprises a nucleotide sequence that is at least about 80% or 85% identical to the sequence set forth in SEQ ID NO: 5, 15, or 17; And
(f) A method comprising a polypeptide encoded by a nucleotide sequence comprising the degenerate codons of (a), (b), (c), (d) or (e).
[92" claim-type="Currently amended] 88. The polypeptide of claim 87, wherein the polypeptide is
(a) the nucleotide sequences set forth in nucleotides 31-729 of SEQ ID NO: 5 or SEQ ID NO: 17;
(b) a nucleotide sequence which hybridizes along its length under high stringent conditions to the nucleotide sequence set forth in nucleotides 31-729 or SEQ ID NO: 17 of SEQ ID NO: 5;
(c) a nucleotide sequence encoding the polypeptide of SEQ ID NO: 16;
(d) a nucleotide sequence that is a splice variant of (a), (b) or (c); And
(e) a method comprising a polypeptide encoded by the degenerate codon of (a), (b), (c) or (d).
[93" claim-type="Currently amended] Contacting the test compound with both single and double stranded forms of the MTSP9 polypeptide;
Determining which form is associated with the compound; And
When bound to a particular type of polypeptide, the compound i) inhibits activating cleavage of the single stranded simogen form of the polypeptide; further determining whether one exhibits at least one of the properties of inhibiting the activity of the double- or single-chain form and iii) the property of inhibiting dimerization of the polypeptide. A method for identifying a compound that binds to the proteolytically active portion of a single-stranded and / or double-stranded form, and / or the single-stranded and / or double-stranded form of the MTSP9 polypeptide according to any one of claims 1-20.
[94" claim-type="Currently amended] A method according to any one of claims 1 to 20 in a biological sample, by detecting the amount, form and / or activity of a polypeptide different from the amount, form and / or activity of a polypeptide detected from a subject not suffering from neoplastic disease. A method for detecting neoplastic disease, comprising detecting a polypeptide comprising a polypeptide.
[95" claim-type="Currently amended] 95. The method of claim 94, wherein the biological sample is selected from the group consisting of blood, urine, saliva, tears, synovial fluid, sweat, matrix fluid, semen, cerebrospinal fluid, ascites, tumor tissue biopsy, and circulating tumor cells.
[96" claim-type="Currently amended] Contacting the test compound with both single and double stranded forms of the polypeptide according to any one of claims 1 to 20;
Determining which form or forms the compound binds to; And
When bound to a particular type of polypeptide, the compound i) inhibits activating cleavage of the single stranded simogen form of the polypeptide; 21. The method of claim 1, further comprising determining whether one or more of ii) a property of inhibiting the activity of a double- or single-chain form and iii) a property of inhibiting dimerization of the polypeptide. A method of identifying a compound that binds to single and / or double stranded forms of a polypeptide according to any one of the preceding claims.
[97" claim-type="Currently amended] 97. The method of claim 96, wherein the biological sample is selected from the group consisting of blood, urine, saliva, tears, synovial fluid, sweat, matrix fluid, cerebrospinal fluid, semen sample, ascites, tumor tissue biopsy, and circulating tumor cells.
[98" claim-type="Currently amended] 97. The method of claim 96, wherein the two forms consist essentially of the protease domain.
[99" claim-type="Currently amended] Obtaining a biological sample from the subject; And
Characterized by the presence or absence of a precancerous lesion, malignant tumor, or a double stranded or single stranded form in a subject, comprising exposing it to a detectable agent that binds to the double stranded and / or single stranded form of the MTSP9 polypeptide. A method of diagnosing the presence of other pathological diseases.
[100" claim-type="Currently amended] A method for monitoring tumor progression and / or therapeutic efficacy, including quantifying and / or detecting MTSP9 polypeptide levels, forms, and / or activities in a body tissue or body fluid sample.
[101" claim-type="Currently amended] 101. The method of claim 100, wherein the tumor is a breast, cervical, prostate, lung, ovarian or colon tumor.
[102" claim-type="Currently amended] 101. The method of claim 100, wherein the body fluid is blood, urine, sweat, saliva, cerebrospinal fluid and synovial fluid.
[103" claim-type="Currently amended] The polypeptide of claim 1, comprising at least amino acids 85-87 and / or 160-165 of SEQ ID NO: 18. 21.
[104" claim-type="Currently amended] A polypeptide according to any one of claims 1 to 20 or a proteolytically active portion thereof is contacted with a substrate to be proteolytically cleaved by such polypeptide, and at the same time, before or after a single or multiple Adding a test compound;
Determining the amount of substrate cleaved in the presence of the test compound; And
A method of identifying a compound that modulates the protease activity of a MTSP9 polypeptide, comprising identifying a compound that modulates the activity of the polypeptide by selecting a compound that changes the amount of cleaved substrate compared to a control.
[105" claim-type="Currently amended] 107. The polypeptide of claim 104, wherein the polypeptide is
(a) the nucleotide sequences set forth in nucleotides 31-729 of SEQ ID NO: 5 or SEQ ID NO: 17;
(b) nucleotide sequences that hybridize to nucleotides 31-729 of SEQ ID NO: 5 or nucleotide sequences set forth in SEQ ID NO: 17 along at least about 70% of their length or full length thereof under high stringent conditions;
(c) a nucleotide sequence encoding the polypeptide of SEQ ID NO: 16;
(d) a nucleotide sequence that is a splice variant of (a), (b) or (c);
(e) a nucleotide sequence encoding a protease domain or catalytically active portion thereof that comprises a nucleotide sequence that is at least about 80% or 85% identical to the sequence set forth in SEQ ID NO: 5, 15, or 17; And
(f) A polypeptide comprising a polypeptide encoded by a nucleotide sequence comprising a degenerate codon of (a), (b), (c), (d) or (e).
[106" claim-type="Currently amended] 107. The polypeptide of claim 104, wherein the polypeptide is essentially
(a) the nucleotide sequences set forth in nucleotides 31-729 of SEQ ID NO: 5 or SEQ ID NO: 17;
(b) nucleotide sequences that hybridize to nucleotides 31-729 of SEQ ID NO: 5 or nucleotide sequences set forth in SEQ ID NO: 17 along at least about 70% of their length or full length thereof under high stringent conditions;
(c) a nucleotide sequence encoding the polypeptide of SEQ ID NO: 16;
(d) a nucleotide sequence that is a splice variant of (a), (b) or (c);
(e) a nucleotide sequence encoding a protease domain or catalytically active portion thereof that comprises a nucleotide sequence that is at least about 80% or 85% identical to the sequence set forth in SEQ ID NO: 5, 15, or 17; And
(f) a method consisting of a polypeptide encoded by a nucleotide sequence comprising a degenerate codon of (a), (b), (c), (d) or (e).
[107" claim-type="Currently amended] The polypeptide of claim 14, wherein the protease domain comprises the amino acid sequence set forth in SEQ ID NO: 16.
[108" claim-type="Currently amended] A transgenic non-human animal comprising a heterologous nucleic acid encoding a polypeptide according to any one of claims 1 to 20.
[109" claim-type="Currently amended] 21 or more contiguous or modified nucleotides identical to the contiguous nucleotide sequence encoding the protease domain of MTSP9 according to any one of claims 1 to 20, or
21 or more contiguous or modified nucleotides identical to the contiguous nucleotide sequence encoding the protease domain of MTSP9 according to any one of claims 1 to 20, or
An antisense molecule comprising at least 30 contiguous or modified nucleotides identical to the contiguous nucleotide sequence encoding the protease domain of MTSP9 according to any one of claims 1 to 20, wherein the antisense molecule is nucleotide 1162- of SEQ ID NO: 18. A probe or primer, comprising 1262.

类似技术:

---

公开号 | 公开日 | 专利标题

---

JP2016155836A|2016-09-01|Modified factor vii polypeptides and uses thereof

---

JP2017029167A|2017-02-09|Protease screening methods and proteases identified thereby

---

JP2018183147A|2018-11-22|Modified factor X polypeptide and use thereof

---

Dunn2002|Structure and mechanism of the pepsin-like family of aspartic peptidases

---

Harris et al.1998|Definition and redesign of the extended substrate specificity of granzyme B

---

Jiang et al.2003|Prophenoloxidase-activating proteinase-3 | from Manduca sexta hemolymph: a clip-domain serine proteinase regulated by serpin-1J and serine proteinase homologs

---

Takeuchi et al.2000|Cellular localization of membrane-type serine protease 1 and identification of protease-activated receptor-2 and single-chain urokinase-type plasminogen activator as substrates

---

JP2015205933A|2015-11-19|Unit dose formulation of antidotes for factor xa inhibitors and methods of using the same

---

CN1468303B|2012-07-18|Factor vii glycoforms

---

Horiuchi et al.2003|Potential role for ADAM15 in pathological neovascularization in mice

---

US6897296B2|2005-05-24|Antibody that specifically binds an Mch5 polypeptide

---

JP4426650B2|2010-03-03|Novel anti-angiogenic peptide, polynucleotide encoding it, and method for inhibiting angiogenesis

---

ES2607935T3|2017-04-04|Antidotes for factor Xa inhibitors and procedures for their use

---

ES2597436T3|2017-01-18|Antidotes for factor Xa inhibitors and procedures for their use

---

US6319704B1|2001-11-20|KUZ, a novel family of metalloproteases

---

Nicholson et al.1989|Human and rat malignant-tumor-associated mRNAs encode stromelysin-like metalloproteinases

---

Behrendt2004|The urokinase receptor | and the uPAR-associated protein |: membrane proteins engaged in matrix turnover during tissue remodeling

---

EP0620854B1|1998-09-16|Expression and purification of recombinant soluble tissue factor

---

US7507403B2|2009-03-24|Kallikrein gene

---

JP5860789B2|2016-02-16|Modified proteases that inhibit complement activation

---

AU735463B2|2001-07-12|Expression of active human factor IX in mammary tissue of transgenic animals

---

US7030231B1|2006-04-18|Membrane type serine protease 1 | and uses thereof

---

AU2008202992B2|2012-03-29|Antibody against enzyme specifically cleaving von villebrand factor and assay system using the same

---

US6395876B1|2002-05-28|High-affinity tryptophan transporter

---

Arribas et al.2002|Protein ectodomain shedding

同族专利:

---

公开号 | 公开日

---

JP2005506047A|2005-03-03|

---

WO2002077267A2|2002-10-03|

---

US20030166851A1|2003-09-04|

---

NZ527971A|2006-03-31|

---

EP1379637A4|2005-04-06|

---

EP1379637A2|2004-01-14|

---

US7105333B2|2006-09-12|

---

CA2442089A1|2002-10-03|

---

WO2002077267A3|2003-09-18|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

法律状态:
2001-03-27|Priority to US27922801P

---

2001-03-27|Priority to US60/279,228

---

2001-05-15|Priority to US29150101P

---

2001-05-15|Priority to US60/291,501

---

2002-03-27|Application filed by 덴드레온 샌 디에고 엘엘씨

---

2002-03-27|Priority to PCT/US2002/009611

---

2003-12-24|Publication of KR20030096292A

优先权:

---

申请号 | 申请日 | 专利标题

---

US27922801P| true| 2001-03-27|2001-03-27|

---

US60/279,228|2001-03-27|

---

US29150101P| true| 2001-05-15|2001-05-15|

---

US60/291,501|2001-05-15|

---

PCT/US2002/009611|WO2002077267A2|2001-03-27|2002-03-27|Nucleic acid molecules encoding a transmembran serine protease 9, the encoded polypeptides and methods based thereon|